ID: 990451197

View in Genome Browser
Species Human (GRCh38)
Location 5:55933189-55933211
Sequence GCCCCAGCTCAGTCCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990451197_990451203 10 Left 990451197 5:55933189-55933211 CCAGGAGAGGACTGAGCTGGGGC No data
Right 990451203 5:55933222-55933244 GAGGCCCAGCAGTAGGTGCCAGG No data
990451197_990451198 -9 Left 990451197 5:55933189-55933211 CCAGGAGAGGACTGAGCTGGGGC No data
Right 990451198 5:55933203-55933225 AGCTGGGGCCCTCTCTCCAGAGG No data
990451197_990451201 3 Left 990451197 5:55933189-55933211 CCAGGAGAGGACTGAGCTGGGGC No data
Right 990451201 5:55933215-55933237 CTCTCCAGAGGCCCAGCAGTAGG No data
990451197_990451206 20 Left 990451197 5:55933189-55933211 CCAGGAGAGGACTGAGCTGGGGC No data
Right 990451206 5:55933232-55933254 AGTAGGTGCCAGGATATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990451197 Original CRISPR GCCCCAGCTCAGTCCTCTCC TGG (reversed) Intergenic
No off target data available for this crispr