ID: 990451199

View in Genome Browser
Species Human (GRCh38)
Location 5:55933211-55933233
Sequence CTGCTGGGCCTCTGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990451199_990451212 18 Left 990451199 5:55933211-55933233 CCCTCTCTCCAGAGGCCCAGCAG No data
Right 990451212 5:55933252-55933274 AGGCCCTTAACTCAGGGGGAAGG No data
990451199_990451206 -2 Left 990451199 5:55933211-55933233 CCCTCTCTCCAGAGGCCCAGCAG No data
Right 990451206 5:55933232-55933254 AGTAGGTGCCAGGATATAGAAGG No data
990451199_990451210 13 Left 990451199 5:55933211-55933233 CCCTCTCTCCAGAGGCCCAGCAG No data
Right 990451210 5:55933247-55933269 ATAGAAGGCCCTTAACTCAGGGG No data
990451199_990451209 12 Left 990451199 5:55933211-55933233 CCCTCTCTCCAGAGGCCCAGCAG No data
Right 990451209 5:55933246-55933268 TATAGAAGGCCCTTAACTCAGGG No data
990451199_990451211 14 Left 990451199 5:55933211-55933233 CCCTCTCTCCAGAGGCCCAGCAG No data
Right 990451211 5:55933248-55933270 TAGAAGGCCCTTAACTCAGGGGG No data
990451199_990451208 11 Left 990451199 5:55933211-55933233 CCCTCTCTCCAGAGGCCCAGCAG No data
Right 990451208 5:55933245-55933267 ATATAGAAGGCCCTTAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990451199 Original CRISPR CTGCTGGGCCTCTGGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr