ID: 990451202

View in Genome Browser
Species Human (GRCh38)
Location 5:55933219-55933241
Sequence GGCACCTACTGCTGGGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990451202_990451206 -10 Left 990451202 5:55933219-55933241 CCAGAGGCCCAGCAGTAGGTGCC No data
Right 990451206 5:55933232-55933254 AGTAGGTGCCAGGATATAGAAGG No data
990451202_990451211 6 Left 990451202 5:55933219-55933241 CCAGAGGCCCAGCAGTAGGTGCC No data
Right 990451211 5:55933248-55933270 TAGAAGGCCCTTAACTCAGGGGG No data
990451202_990451215 24 Left 990451202 5:55933219-55933241 CCAGAGGCCCAGCAGTAGGTGCC No data
Right 990451215 5:55933266-55933288 GGGGGAAGGAGAGAGAAGAATGG No data
990451202_990451212 10 Left 990451202 5:55933219-55933241 CCAGAGGCCCAGCAGTAGGTGCC No data
Right 990451212 5:55933252-55933274 AGGCCCTTAACTCAGGGGGAAGG No data
990451202_990451209 4 Left 990451202 5:55933219-55933241 CCAGAGGCCCAGCAGTAGGTGCC No data
Right 990451209 5:55933246-55933268 TATAGAAGGCCCTTAACTCAGGG No data
990451202_990451210 5 Left 990451202 5:55933219-55933241 CCAGAGGCCCAGCAGTAGGTGCC No data
Right 990451210 5:55933247-55933269 ATAGAAGGCCCTTAACTCAGGGG No data
990451202_990451208 3 Left 990451202 5:55933219-55933241 CCAGAGGCCCAGCAGTAGGTGCC No data
Right 990451208 5:55933245-55933267 ATATAGAAGGCCCTTAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990451202 Original CRISPR GGCACCTACTGCTGGGCCTC TGG (reversed) Intergenic
No off target data available for this crispr