ID: 990451206

View in Genome Browser
Species Human (GRCh38)
Location 5:55933232-55933254
Sequence AGTAGGTGCCAGGATATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990451202_990451206 -10 Left 990451202 5:55933219-55933241 CCAGAGGCCCAGCAGTAGGTGCC No data
Right 990451206 5:55933232-55933254 AGTAGGTGCCAGGATATAGAAGG No data
990451199_990451206 -2 Left 990451199 5:55933211-55933233 CCCTCTCTCCAGAGGCCCAGCAG No data
Right 990451206 5:55933232-55933254 AGTAGGTGCCAGGATATAGAAGG No data
990451200_990451206 -3 Left 990451200 5:55933212-55933234 CCTCTCTCCAGAGGCCCAGCAGT No data
Right 990451206 5:55933232-55933254 AGTAGGTGCCAGGATATAGAAGG No data
990451197_990451206 20 Left 990451197 5:55933189-55933211 CCAGGAGAGGACTGAGCTGGGGC No data
Right 990451206 5:55933232-55933254 AGTAGGTGCCAGGATATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990451206 Original CRISPR AGTAGGTGCCAGGATATAGA AGG Intergenic
No off target data available for this crispr