ID: 990452768

View in Genome Browser
Species Human (GRCh38)
Location 5:55951504-55951526
Sequence CAGCATACACAGATGAAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990452768_990452773 16 Left 990452768 5:55951504-55951526 CCCACCTTCATCTGTGTATGCTG 0: 1
1: 0
2: 0
3: 13
4: 172
Right 990452773 5:55951543-55951565 CAATGTGTCACTAGTCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990452768 Original CRISPR CAGCATACACAGATGAAGGT GGG (reversed) Exonic
900242516 1:1623785-1623807 CAGCAGTCACAGATGATGTTGGG - Exonic
901551981 1:10002265-10002287 GAGCATATACACCTGAAGGTAGG - Intronic
905351340 1:37348634-37348656 CGGGATACACAGATGAACCTGGG - Intergenic
908822472 1:68102604-68102626 CAGCAAATACAGATGAATATAGG - Intronic
909649192 1:77954273-77954295 CAGCATACTCTGATTAAGGTTGG - Intronic
910149401 1:84124577-84124599 CAGCATAAAGAGGTGAAGGTAGG - Intronic
910584923 1:88869033-88869055 CAGAATACACAGATACAGGCCGG - Intronic
912547392 1:110460802-110460824 AAGGATACACAAATGAAGGAAGG - Intergenic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
912922158 1:113879605-113879627 CAGCAAACACAGCTGTAGATAGG - Intronic
913032604 1:114924768-114924790 AAGCATGGAGAGATGAAGGTGGG + Intronic
913486972 1:119340591-119340613 CACAAAACACAGATAAAGGTAGG - Intergenic
914200799 1:145483554-145483576 AAGCATACATAGAAAAAGGTGGG + Intergenic
914479912 1:148056682-148056704 AAGCATACATAGAAAAAGGTGGG + Intergenic
915626482 1:157117265-157117287 CAGCACAAACAGATGATGGCAGG - Intergenic
915850179 1:159313505-159313527 TAGCATACACTTATGAATGTAGG - Intergenic
916531186 1:165658194-165658216 CAGCTTACACAGCTGTAAGTTGG + Intronic
916839458 1:168584799-168584821 CAGCATGCTCAGATGAGGGATGG + Intergenic
917150501 1:171938713-171938735 CATCATACATATATTAAGGTCGG + Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
920570912 1:207016600-207016622 CAGCACACACAGATGCAGATAGG + Intronic
921922460 1:220685131-220685153 CAGCATAAACAGTTGAAGCATGG - Intergenic
1063045954 10:2392730-2392752 CAGCACACACAGAGGATGCTTGG - Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1066638998 10:37536814-37536836 CAGCATACTGAGCTGGAGGTGGG - Intergenic
1067407037 10:46032602-46032624 AAGCAAACACAGAGGAATGTGGG + Intergenic
1067540239 10:47145516-47145538 CAGCATACACACATGTGGGTTGG + Intergenic
1070162182 10:73873469-73873491 CAGCAGGAACAGTTGAAGGTCGG + Intronic
1071113864 10:82194251-82194273 CAGCATGCACAGATGATTTTTGG + Intronic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1074429644 10:113383106-113383128 CAGCATAAACAAATGAATGAAGG - Intergenic
1078606742 11:12783922-12783944 CAGCATATACACAGGAAGGGGGG + Intronic
1083672434 11:64306757-64306779 CAGAATACCCAGATGAGGGCAGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086293472 11:85337652-85337674 CAGCATAAGCAGATGAACTTAGG - Intronic
1086831360 11:91569003-91569025 CAGCTAACTCAGATGAAGGCAGG - Intergenic
1088970021 11:114765691-114765713 AGGTATACACAGATGAAAGTAGG - Intergenic
1089168434 11:116495672-116495694 CAGCAAATACAGAGAAAGGTAGG - Intergenic
1093260302 12:16928141-16928163 CAACAAACACAGCTGCAGGTTGG - Intergenic
1097518861 12:60643560-60643582 AAGCTTTCACAGATGAATGTTGG - Intergenic
1098155590 12:67594391-67594413 CAGTCAACACTGATGAAGGTTGG + Intergenic
1099613408 12:84905653-84905675 CAGGACCCACAGATGAATGTGGG - Intronic
1101587687 12:106099369-106099391 CAGCATCCAAGGAAGAAGGTTGG - Intronic
1101619888 12:106375089-106375111 CAGAATACACAAATCGAGGTTGG + Intronic
1103134456 12:118495836-118495858 CAGCATCCACAGCTGAAGTGGGG - Intergenic
1103597101 12:122030589-122030611 CAGATCACACAGATGAGGGTTGG - Intronic
1103919325 12:124391201-124391223 CAACATCCCCAGATGCAGGTGGG - Intronic
1104756114 12:131270331-131270353 CAGCATCATCAGATGAAGGCAGG + Intergenic
1104777662 12:131400694-131400716 CAGCATCATCAGATGAAGGCAGG - Intergenic
1108743108 13:53359440-53359462 CTGCAGACACAGATGTACGTGGG + Intergenic
1113155950 13:107322144-107322166 GAGCATATACAAAAGAAGGTTGG - Intronic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1115147414 14:30241410-30241432 GAGCATACACAGATGGGGTTAGG - Intergenic
1117463405 14:55968995-55969017 GGGCAGATACAGATGAAGGTTGG + Intergenic
1119925861 14:78493127-78493149 CAGCATCCCCAGAAGAACGTTGG - Intronic
1119971015 14:78970782-78970804 AACCATACTCAGAGGAAGGTCGG - Intronic
1119981506 14:79087010-79087032 CAGCAGACACACCTGAATGTTGG + Intronic
1122024413 14:98864685-98864707 CAGCACACACAGTGGATGGTGGG - Intergenic
1125341838 15:38683124-38683146 CAGCACAGACAGATGAGGGATGG - Intergenic
1126943252 15:53789107-53789129 CATCTTACACATTTGAAGGTAGG - Intergenic
1127130920 15:55862421-55862443 CAGCACGCACAGATCAAGGACGG - Intronic
1131865313 15:96702572-96702594 CAGGATACACAGAAAAATGTAGG - Intergenic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1139386530 16:66576067-66576089 CAGCACACAAAGAAGCAGGTTGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1150113536 17:62523638-62523660 CAGCATTAACTGATGAAGATGGG - Intronic
1151385113 17:73750437-73750459 CAGCACAAACAGAGGGAGGTGGG + Intergenic
1153526493 18:5999455-5999477 CAGCACACTCTGAGGAAGGTAGG - Intronic
1158259891 18:55594940-55594962 CAGCATACACAAGGGAAGGCAGG + Intronic
1159165139 18:64689478-64689500 CAGTATGCACAGATAAAAGTTGG - Intergenic
1159839461 18:73381362-73381384 CAGCATATTCAGGGGAAGGTGGG + Intergenic
925075963 2:1015850-1015872 CAGCAGATACAGATGATGCTGGG - Intronic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
926357057 2:12050336-12050358 CAGAATCCAGAGATAAAGGTGGG + Intergenic
933429588 2:82158768-82158790 AATCATACACACATGAAGATTGG + Intergenic
933725042 2:85421907-85421929 CAGGATACACAGGTGAGGTTGGG - Intronic
934065814 2:88340638-88340660 CAACAAACACAGATGATAGTTGG + Intergenic
935389174 2:102532433-102532455 GAGCCTACACAGAGGAAGGAAGG + Exonic
935467774 2:103419476-103419498 CAGCATATACAGATACAGGCTGG + Intergenic
937744314 2:125393173-125393195 ATGCAAACACATATGAAGGTTGG + Intergenic
939275860 2:139994892-139994914 CAACAGGCAGAGATGAAGGTCGG - Intergenic
940087521 2:149877405-149877427 CAGCATACACAGTTCTGGGTTGG - Intergenic
941098529 2:161270504-161270526 CATAATACTCAGCTGAAGGTAGG - Intergenic
942377289 2:175350636-175350658 CAGCACACACATCTGTAGGTGGG + Intergenic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
948672204 2:239575742-239575764 CAGGACACAGAGATGAAGGCTGG - Intergenic
1169944625 20:10975458-10975480 CAGCATAAATAGATTAAGATAGG - Intergenic
1171055289 20:21900653-21900675 CAGCACACACAGGTGAAAGTGGG + Intergenic
1172825607 20:37781509-37781531 CAGCATTCAAAAATGAAGTTAGG - Intronic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1174494373 20:50930020-50930042 CAGCAGACAGGGATCAAGGTTGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1179592586 21:42419152-42419174 GAGCATACACAGTTGTTGGTGGG + Intronic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1184947122 22:47811378-47811400 CAGCACACACAGAAGCAGGCAGG - Intergenic
951249373 3:20376810-20376832 CAGGTTACACTGATGATGGTTGG - Intergenic
951760890 3:26146510-26146532 CATCATACACAGAAGATGGATGG + Intergenic
952006519 3:28847757-28847779 AAGCATATACAGAAGTAGGTTGG - Intergenic
952962000 3:38598177-38598199 CAGGAAACAAAGATGGAGGTGGG + Intronic
955884964 3:63588332-63588354 CAGGAGACACAGTGGAAGGTTGG - Intronic
956696287 3:71921897-71921919 CTGAATACACATAGGAAGGTGGG - Intergenic
957737933 3:84226242-84226264 CATAAGACAGAGATGAAGGTTGG - Intergenic
958818547 3:98946410-98946432 CAGCATACAAAGTGGGAGGTAGG + Intergenic
962002647 3:131315227-131315249 AAGCATACACAGTTGCAGGTAGG - Intronic
963356117 3:144210482-144210504 GTGCACACCCAGATGAAGGTTGG + Intergenic
966308953 3:178572148-178572170 CAGCATATACAAAAGAAGGGTGG + Intronic
967931975 3:194696502-194696524 CGACGTACAAAGATGAAGGTAGG - Intergenic
968801791 4:2747674-2747696 CAGCATGCACAAAGGAATGTGGG - Exonic
969317025 4:6388542-6388564 CAGCACACACAGATACAGGGAGG + Intronic
969841839 4:9888620-9888642 CAGCCTACAGAGATGAACGCAGG - Intronic
971364269 4:25964988-25965010 CACCAGGCACAGAGGAAGGTGGG - Intergenic
971455436 4:26839848-26839870 CAGTCTACACAGGTGAAGCTGGG + Intergenic
975489593 4:74974136-74974158 GAGCACACACAGAGGAAGGAGGG - Intronic
975821010 4:78270462-78270484 CAAAATACACAGAAGAGGGTAGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
980327297 4:131363610-131363632 GAGCAGATACATATGAAGGTAGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984080361 4:175241202-175241224 CAGCATTCACAGAAGAAGCAGGG + Intergenic
986743860 5:10727354-10727376 CAGCACACCCTGATGAAGGCAGG + Intronic
989666203 5:43857379-43857401 AGGCATAGACATATGAAGGTAGG - Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
992381917 5:76246000-76246022 CAGCATATAGAGATTATGGTTGG + Intronic
993914119 5:93720924-93720946 CAGAATATACACATGAAGGTGGG - Intronic
994341503 5:98634682-98634704 CAGCATACAGTGAAGAAAGTTGG - Intergenic
995517294 5:112966856-112966878 TAGCAGAGACAGATGAAGATGGG + Intergenic
998488711 5:142526993-142527015 CAGCATAGACAGTGCAAGGTAGG + Intergenic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999516995 5:152311374-152311396 CAGCATAAGCAGATCAAGGAGGG - Intergenic
999545004 5:152618182-152618204 AAACATATACAGATGGAGGTGGG - Intergenic
1004342612 6:14820692-14820714 CAGCATACACAGATATTGGCAGG - Intergenic
1004885612 6:20049120-20049142 CAGCCTGCACACATGAAGGTAGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1009411383 6:63369106-63369128 CTTCATACACAGATAAATGTTGG + Intergenic
1012466479 6:99521717-99521739 CTGCATCCACAGATAAAAGTTGG - Intronic
1018662978 6:166105432-166105454 GAGCAGACACAGGTGGAGGTAGG + Intergenic
1019103075 6:169647787-169647809 CAGCATACACGTGTGCAGGTGGG + Exonic
1019513622 7:1430228-1430250 CAGCTTACACAGATCAGGGTGGG + Intronic
1020066877 7:5195089-5195111 CACCAGGCACAGTTGAAGGTGGG + Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1021513126 7:21455738-21455760 CATAAGACAGAGATGAAGGTTGG - Intronic
1022124356 7:27341163-27341185 AAGTATGCACAGATCAAGGTTGG + Intergenic
1023280968 7:38569121-38569143 CAGCAAAAATAGATGAGGGTTGG - Intronic
1023294133 7:38697646-38697668 TAAAATACACAGATGAATGTGGG + Intergenic
1024851232 7:53719874-53719896 CAGCATTTACAGGTGAACGTAGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1031365070 7:120891083-120891105 CAGCAAACAGAGATAAGGGTGGG + Intergenic
1031735198 7:125350901-125350923 TAGCCTACACCGATGAAGGTGGG - Intergenic
1032043235 7:128579401-128579423 CAGCATTAACTGATGAAGATGGG - Intergenic
1033463883 7:141573018-141573040 CTTCATCCACAGCTGAAGGTAGG + Intronic
1034051475 7:147988708-147988730 CAGCATCCCCAGATGCAGGCGGG + Intronic
1034065632 7:148133947-148133969 CAGCATAGGCAAATGCAGGTGGG + Intronic
1034464576 7:151219059-151219081 CAGATTGCACACATGAAGGTAGG - Exonic
1036071244 8:5442000-5442022 CAGCAAACGGAGATGAGGGTGGG + Intergenic
1036519290 8:9475349-9475371 CAGCATGCACAGAGAAGGGTAGG + Intergenic
1038114769 8:24541127-24541149 CAGAATACACATCTGAAGATTGG - Intergenic
1038418971 8:27420003-27420025 CTGCACCCACAGATGACGGTGGG + Exonic
1039145872 8:34446412-34446434 CACCATATACAAATGAAGTTTGG + Intergenic
1039806144 8:41001359-41001381 CAGCAATAACAGATGTAGGTGGG + Intergenic
1042113416 8:65405729-65405751 AAGCATACACATAAGAAGGCTGG + Intergenic
1042444791 8:68871347-68871369 CAGAAAACAAAGATGGAGGTAGG - Intergenic
1042689951 8:71486623-71486645 CTGCTTACACAGAGGAGGGTGGG - Intronic
1043347741 8:79319578-79319600 CACCATGCAAAGATGAAGGCAGG - Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1045495248 8:102702606-102702628 CAGCACAAACAGATAAAGCTGGG - Intergenic
1045544242 8:103113889-103113911 CAGCAAACACAGTAGAAGGGAGG + Intergenic
1046662905 8:116967955-116967977 CTGCACAAACAGATGAGGGTTGG + Intronic
1049016129 8:139921447-139921469 CAGCTTACACAAATGAAGCCCGG - Intronic
1049222485 8:141434344-141434366 CAGCCTCCAGACATGAAGGTGGG + Intergenic
1051795465 9:20864141-20864163 AAACACACACAGATGAAAGTGGG - Intronic
1058588524 9:106535794-106535816 CATCCAACACAGATGAAGGTAGG + Intergenic
1060258499 9:122053455-122053477 CAGCCCACACAGATCACGGTAGG + Intronic
1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG + Intronic
1186633181 X:11373212-11373234 CAGGATACACAGATGTTAGTAGG + Intronic
1187608352 X:20911951-20911973 AAGCAGACAGAGATGGAGGTGGG - Intergenic
1188330639 X:28866864-28866886 CAGACTACACAGATAAAGTTAGG + Intronic
1188368836 X:29343900-29343922 CACCACACACAAATGTAGGTAGG + Intronic
1188976614 X:36683267-36683289 CTGCATACACAGGGAAAGGTGGG + Intergenic
1188985982 X:36768730-36768752 CACCATCCACACATGAAGGGAGG + Intergenic
1189418127 X:40832584-40832606 CAGCATGCACAAAGGAACGTGGG - Intergenic
1190421046 X:50284811-50284833 CAGCGTTCACAGAGGATGGTAGG + Intronic
1198528887 X:137529653-137529675 CTGCATACTCATATGAAGGAAGG - Intergenic