ID: 990455781

View in Genome Browser
Species Human (GRCh38)
Location 5:55986185-55986207
Sequence CTTCTATCATTGTTCAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990455779_990455781 0 Left 990455779 5:55986162-55986184 CCTTACTGATTTTCTGACTACTA 0: 1
1: 4
2: 33
3: 213
4: 605
Right 990455781 5:55986185-55986207 CTTCTATCATTGTTCAAAAAGGG 0: 1
1: 0
2: 2
3: 24
4: 276
990455778_990455781 6 Left 990455778 5:55986156-55986178 CCATATCCTTACTGATTTTCTGA 0: 1
1: 5
2: 21
3: 92
4: 395
Right 990455781 5:55986185-55986207 CTTCTATCATTGTTCAAAAAGGG 0: 1
1: 0
2: 2
3: 24
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990455781 Original CRISPR CTTCTATCATTGTTCAAAAA GGG Intronic
900547782 1:3238065-3238087 CTTCTCTCATTGGCCAAAGAGGG + Intronic
903194907 1:21678432-21678454 CTTAGATCATTGTTTAAAAAAGG - Intronic
903545322 1:24120358-24120380 CTTCTGTCATTGTTCAAAGGTGG - Exonic
905193952 1:36259463-36259485 GTTGAATCATTGTTCAAATAAGG + Exonic
905409205 1:37756653-37756675 CTGCCAGCATTGTTCAACAAAGG - Intronic
906544331 1:46610807-46610829 CTTTTATCATAGTCTAAAAAGGG - Intronic
906784885 1:48606569-48606591 GTTTCATCATTCTTCAAAAAAGG + Intronic
907745228 1:57206600-57206622 GTTCTCTCTTTGCTCAAAAACGG + Intronic
908950459 1:69556223-69556245 ATTATAGCATTGTTCAAGAAAGG - Intergenic
909067348 1:70951213-70951235 TTTCTTTTATTATTCAAAAATGG - Intronic
909412932 1:75375601-75375623 TTTCTATCACTGTTCACAAAGGG + Intronic
909621810 1:77676490-77676512 ATTTTATCTCTGTTCAAAAAGGG + Intronic
911567342 1:99478496-99478518 CTTCACTCATTTTTGAAAAATGG - Intergenic
911669842 1:100595155-100595177 CTCCTATCATTTTTAAAAATAGG + Intergenic
913967635 1:143390517-143390539 CTTCCATCATTGTTGAGAGATGG + Intergenic
914062009 1:144216107-144216129 CTTCCATCATTGTTGAGAGATGG + Intergenic
914117141 1:144750247-144750269 CTTCCATCATTGTTGAGAGATGG - Intergenic
918102950 1:181392307-181392329 TTCCTATCATTCTTCAAGAATGG + Intergenic
918383084 1:183976776-183976798 CGTATATCATTGTGCCAAAAAGG + Intronic
922982254 1:229837235-229837257 CTTGTGTCATTTTACAAAAATGG + Intergenic
923953193 1:238984305-238984327 ATTCTATCATGGGCCAAAAATGG + Intergenic
923974212 1:239241663-239241685 TTACTAACATTATTCAAAAAAGG + Intergenic
1063778750 10:9295714-9295736 CTTCAATCAATCTTCAAACAAGG + Intergenic
1064402666 10:15034440-15034462 GTTCTAATAATGTTCAAAAAGGG - Intronic
1064843300 10:19621029-19621051 CTTCTGTCATTGTAGTAAAATGG - Intronic
1064921204 10:20520616-20520638 CTCCTATCATTGTTAAGACAAGG - Intergenic
1064955279 10:20901467-20901489 GTTCTATCATTATGAAAAAAAGG - Intronic
1065795347 10:29302443-29302465 CTTCCATGATTATTCATAAACGG + Intronic
1066650163 10:37647504-37647526 CTGCTATCTTGGTTTAAAAATGG + Intergenic
1069152594 10:64983050-64983072 TTTCTATCAATGTTAAAACAAGG - Intergenic
1069156891 10:65040433-65040455 CTTCTATCATGTTTCACAAACGG - Intergenic
1069457530 10:68564604-68564626 CATCTATCATTGGCCAAGAAGGG - Intronic
1070374837 10:75819525-75819547 CTTTTATCATAGTCAAAAAAAGG - Intronic
1071716880 10:88106011-88106033 CTTCATTCGTTTTTCAAAAAGGG + Intergenic
1071915766 10:90293774-90293796 ATTTTATCATTGTGCAAACATGG + Intergenic
1073527033 10:104193215-104193237 ATACTATCATTTTTTAAAAACGG - Intronic
1074906666 10:117870174-117870196 TTTCTATCATCATTTAAAAAAGG - Intergenic
1076444677 10:130505314-130505336 TTTCTATCATTGTTGAGAGAGGG + Intergenic
1076490206 10:130855488-130855510 GTTAAATAATTGTTCAAAAACGG + Intergenic
1078055382 11:8004767-8004789 AAAATATCATTGTTCAAAAAAGG - Intergenic
1079676215 11:23230256-23230278 CTACTAGCATTTTTCAAAAGGGG - Intergenic
1079787886 11:24698478-24698500 CTTTTATAGTTCTTCAAAAAAGG + Intronic
1081251772 11:40844773-40844795 TTTCTTTCATTGTTGTAAAATGG - Intronic
1081265378 11:41014660-41014682 GGACTATCCTTGTTCAAAAAGGG + Intronic
1083969324 11:66063814-66063836 GTTCAATAATTGTTTAAAAAAGG - Intronic
1085559785 11:77460747-77460769 CTTCTTTCATTGTAAAAGAAGGG + Intronic
1086469864 11:87096585-87096607 CCTGTATCAGTATTCAAAAAAGG - Intronic
1086679220 11:89648405-89648427 CTTCTATCAGTGTCAGAAAAGGG + Intergenic
1087361539 11:97166568-97166590 CACCTAACATTTTTCAAAAAAGG - Intergenic
1088153379 11:106775428-106775450 CTTCTATCATTGCTAATAACAGG + Intronic
1088308956 11:108440119-108440141 CTTCTTACATTGTTCTGAAAAGG + Intronic
1088652381 11:111969261-111969283 CTTCTCTCTTTTTTAAAAAATGG - Intronic
1088977631 11:114829909-114829931 ATTCTATTATTTTTCAAACATGG + Intergenic
1092343662 12:7697688-7697710 CTACTCTTATTGTTGAAAAAAGG - Intergenic
1093957399 12:25236604-25236626 CTTCTATAAATGTTAAAAATGGG + Intronic
1094292583 12:28868777-28868799 CTTCTTACATACTTCAAAAAGGG - Intergenic
1095045883 12:37504447-37504469 CTTATAACAATGTTCACAAATGG - Intergenic
1095276696 12:40293459-40293481 CTTCTATCATAGTTCAATCATGG - Intronic
1096890458 12:54765310-54765332 CTTCTCTGATTGTTCACAAGTGG - Intergenic
1097587536 12:61532216-61532238 CTTCTATCATAGTGCAGAGAAGG + Intergenic
1097905095 12:64911380-64911402 ATTATATCATTGTTTAGAAATGG - Intergenic
1097996166 12:65889999-65890021 CTTCTATAATTGCTACAAAATGG + Intronic
1098272633 12:68783858-68783880 CTTCCATTATGGTCCAAAAAGGG + Intronic
1098976667 12:76909283-76909305 CTTTTATCATTGCTGATAAATGG + Intergenic
1099313418 12:81056304-81056326 CTTCTATCATTGTCTACACAAGG + Intronic
1100003839 12:89870124-89870146 CCTTTATCATTGTTCATAAAAGG - Intergenic
1102287401 12:111669773-111669795 CTTATACCATTCTTTAAAAAAGG + Intronic
1103754873 12:123196924-123196946 TTTATATCAATGTTCAGAAAAGG + Intronic
1104336629 12:127901995-127902017 CTTCTTTCACTGTGCAAATAAGG - Intergenic
1105762048 13:23524321-23524343 CCTATATCATTGTTCAGAATTGG - Intergenic
1105818942 13:24062794-24062816 CTTCTCTCAATCTTCAAGAAGGG - Intronic
1107722503 13:43263527-43263549 CTTTTAAAATTTTTCAAAAAGGG + Intronic
1108230007 13:48328003-48328025 CTTATACCATTCTTAAAAAAAGG + Intronic
1109631820 13:65059267-65059289 CTTTTATCATTTTTAACAAATGG - Intergenic
1110641782 13:77833100-77833122 ATTTTATCATTTTTGAAAAATGG + Intergenic
1112100719 13:96186218-96186240 CTTCTTTCATTTTTCACAAAAGG - Intronic
1113170604 13:107498417-107498439 TTCCTGTCATTGTTAAAAAATGG + Intronic
1114880786 14:26783016-26783038 CTAATATTATTGTTGAAAAATGG + Intergenic
1115119006 14:29917016-29917038 CTCCTCACATTGTTCAGAAATGG - Intronic
1116273695 14:42804520-42804542 CTTTTATAAATGTTCAACAAGGG + Intergenic
1117910187 14:60629734-60629756 CTTCTAGTCTTGTTCAGAAAGGG - Intergenic
1118007783 14:61580332-61580354 CTTCTCTCATTTTTCAATCATGG + Intronic
1120492330 14:85193217-85193239 TTTCTATCATTCTTCAAGCATGG - Intergenic
1121965629 14:98301691-98301713 CCTCTATCATTTTTTAAAAACGG + Intergenic
1124007381 15:25805355-25805377 CTGCCTTCATTGTTGAAAAAAGG + Intronic
1124716608 15:32068925-32068947 TTTCTATCATTATTGAAAGAGGG - Intronic
1127283425 15:57511695-57511717 TTTCTATCATTTTTCAAGATTGG - Intronic
1127351642 15:58158778-58158800 CATCAAACATTGTCCAAAAATGG - Intronic
1127399207 15:58569173-58569195 TTTCTAGCATGGTTCAAAAATGG - Exonic
1127555517 15:60083476-60083498 TTTCTATCACTGTTTGAAAAGGG - Intergenic
1128528376 15:68427963-68427985 CCTCTAATATGGTTCAAAAATGG - Intronic
1129087971 15:73117374-73117396 TTTCCATCATTCTTCAAATAAGG - Intronic
1131612632 15:93981233-93981255 CTTCTATCCTTGAGCTAAAAGGG - Intergenic
1133585100 16:7185887-7185909 ATTGTATCATTGCTCAAGAATGG - Intronic
1133979728 16:10624195-10624217 CTTCTGTCATTATTTAAAAGAGG - Intergenic
1135193366 16:20373695-20373717 GTTCAATCATTGTTAAAATAAGG + Intronic
1136557346 16:31015310-31015332 CTTCTATCAAAGTTCAACTACGG + Intergenic
1139165631 16:64562140-64562162 CTTCTATCACTGTTTAGGAAGGG - Intergenic
1140646084 16:77031617-77031639 CCATTATCATTGTCCAAAAATGG - Intergenic
1140726169 16:77814599-77814621 CTTCTAGCATTTTTCCAACAGGG + Intronic
1141264664 16:82486086-82486108 GTTCTATCAATGTTAAAGAAAGG - Intergenic
1142916622 17:3145350-3145372 ATTCTATCATTGTTGAGAGAGGG + Intergenic
1143287366 17:5800386-5800408 CTTCCATCTTTGATCAAAACGGG + Intronic
1143992876 17:10981574-10981596 ATTTTTTGATTGTTCAAAAAAGG - Intergenic
1144313375 17:14035290-14035312 AGTCTATGATTGTTCATAAATGG - Intergenic
1144406199 17:14954957-14954979 CATATATCAATGTTCAAAATGGG - Intergenic
1145085410 17:19934351-19934373 CTTCTTTAATTGTTCAAGACAGG + Intronic
1146297665 17:31662263-31662285 CTTCTATCTGTGAACAAAAAAGG - Intergenic
1149010013 17:51846442-51846464 CTTAGATCATTGTGCAACAAGGG - Intronic
1149202252 17:54200675-54200697 CTTCTATCACAGTTAATAAATGG - Intergenic
1150842247 17:68619756-68619778 CTTTTACCATTGATCAGAAATGG + Intergenic
1150955394 17:69853534-69853556 CTTTTATCATTATTCTAAGAAGG - Intergenic
1154239790 18:12642317-12642339 CTTCTATCCTAATTCAGAAATGG + Intronic
1155751010 18:29422375-29422397 CTTTTATAAATGTTCAAAAAGGG - Intergenic
1155851514 18:30780623-30780645 CTTTTATTTTTGTTAAAAAAAGG - Intergenic
1157075737 18:44465439-44465461 CTTCAGTCATAGTTCACAAAGGG + Intergenic
1158744048 18:60177159-60177181 ATTATATCATTTTTAAAAAATGG - Intergenic
1159125810 18:64222884-64222906 ATGCTATCATTAATCAAAAAAGG - Intergenic
1164703067 19:30299896-30299918 ATTTTATGATTTTTCAAAAAAGG - Intronic
1202701421 1_KI270712v1_random:167985-168007 CTTCCATCATTGTTGAGAGATGG + Intergenic
925358210 2:3257749-3257771 CTTCAATAGTTCTTCAAAAAAGG + Intronic
925699705 2:6623610-6623632 TTTCTTTCATTGATCAAAAAAGG + Intergenic
927536184 2:23861285-23861307 TTTCTACCATTGCACAAAAAAGG + Intronic
929424850 2:41833763-41833785 CTGCTCTCACTGTTCAGAAATGG - Intergenic
929753273 2:44739863-44739885 CTTCCATCAGTATTCAAACATGG - Intronic
933609500 2:84419129-84419151 CTTCTAGCAATCTTCAAAACAGG + Intergenic
933875486 2:86616781-86616803 CTTTTGTCATAGTTCAAAGAAGG - Intronic
934172333 2:89551432-89551454 CTTCCATCATTGTTGAGAGATGG + Intergenic
934282646 2:91625784-91625806 CTTCCATCATTGTTGAGAGATGG + Intergenic
934562917 2:95322547-95322569 ATTCTATCAGTGTCCATAAAGGG + Intronic
936479688 2:112874547-112874569 ATTCTTACATTGTTTAAAAATGG - Intergenic
938634799 2:133211867-133211889 CTTCTATAATGTTTTAAAAAGGG + Intronic
939268522 2:139908118-139908140 CTTACATCATTATTAAAAAATGG - Intergenic
939421744 2:141980388-141980410 CTTATATCATTGTATAAAATAGG - Intronic
941335278 2:164236335-164236357 CTTCAGCCATGGTTCAAAAAAGG + Intergenic
942293107 2:174491542-174491564 CTTCTCTTATGGTTCTAAAATGG - Intergenic
943974483 2:194455383-194455405 CTTTAATCAATGTTGAAAAATGG + Intergenic
944160848 2:196657804-196657826 GTACTATCATTGTTAAAAAATGG - Intronic
944380361 2:199102248-199102270 CTACTATTATTTTACAAAAATGG + Intergenic
945426541 2:209711479-209711501 ATGTTATCATTGTTCTAAAAGGG - Intronic
945547842 2:211179714-211179736 GTTTTATGATTTTTCAAAAAGGG - Intergenic
945653894 2:212599574-212599596 CTTATACCATTAATCAAAAAAGG - Intergenic
945806584 2:214497841-214497863 TTACTATCATTGTTGAAAGATGG - Intronic
1169880959 20:10345924-10345946 CTTCTTTCAGTGTTAAAACATGG - Intergenic
1170724772 20:18916637-18916659 ATTCTATCATGGGTCAAAATTGG - Intergenic
1170775858 20:19374160-19374182 TTTCCATCATGTTTCAAAAATGG + Intronic
1171540449 20:25948043-25948065 CTTATAACAATGTTCACAAATGG - Intergenic
1171800629 20:29612275-29612297 CTTATAACAATGTTCACAAATGG + Intergenic
1171843478 20:30244421-30244443 CTTATAACAATGTTCACAAATGG - Intergenic
1172584793 20:36075440-36075462 GTTCTATACCTGTTCAAAAAAGG + Intergenic
1172586207 20:36086855-36086877 CTCCTTTCAATGTTCAAAAATGG - Intergenic
1172653350 20:36521295-36521317 CATCTATCAGAGTTCTAAAAGGG - Intronic
1173057938 20:39634595-39634617 CTTCTATCTCTGTTCATGAATGG - Intergenic
1174986062 20:55453415-55453437 CTTCTATGGGTGGTCAAAAATGG - Intergenic
1175272964 20:57747948-57747970 CTGCTCTCTTGGTTCAAAAAAGG + Intergenic
1175601781 20:60280139-60280161 CTTCTATCCTCTTTCAAAATTGG - Intergenic
1175770888 20:61623396-61623418 CTTCAATCACTGTTCTAAACGGG - Intronic
1176322242 21:5341018-5341040 TTTCTACCATTGATCACAAAGGG - Intergenic
1176479898 21:7272804-7272826 TTTCTACCATTGGTCACAAAGGG - Intergenic
1178609750 21:34070741-34070763 CTTCTGTGCTTGTTAAAAAAAGG + Intergenic
1179031584 21:37724965-37724987 TTTCTGTCATGGTTAAAAAAAGG - Intronic
1179237598 21:39561304-39561326 TTTCTATGATGGTTCAAATAAGG + Intronic
1181956903 22:26594043-26594065 CTTCTATCAGTGTACTAGAAAGG - Intronic
1182093306 22:27610270-27610292 CTCCCTTCCTTGTTCAAAAAAGG + Intergenic
950080386 3:10217931-10217953 CTTCCCTCATTTTTCAAAAGAGG + Intronic
951224193 3:20101735-20101757 TTTCTATGATTGTACCAAAAAGG + Intronic
951849746 3:27125990-27126012 CTTCTCTACTTGTTCAAAACAGG + Intronic
952140321 3:30471700-30471722 CGTCTGTCATTTTTTAAAAATGG - Intergenic
952539526 3:34352963-34352985 CTTCTATCAATGATGAGAAATGG + Intergenic
953114529 3:39978945-39978967 GTTATATCATTTTTCAAAAGTGG - Intronic
954642455 3:52109154-52109176 ATTGTGTCATTGTTCAAATAAGG - Intronic
956204759 3:66743481-66743503 TTTTTATCATTTTTCAAACAAGG + Intergenic
957651872 3:83017627-83017649 GTTCTATGATAGTTTAAAAATGG - Intergenic
957852205 3:85822798-85822820 GTTCTATCAGTGTTCTAAAATGG + Intronic
958070200 3:88600178-88600200 CTTCTAACTTTCTTCAACAAAGG - Intergenic
958182644 3:90080458-90080480 CTTCTATAATTTTTAAAAATAGG + Intergenic
959058491 3:101592808-101592830 CTTATACCATTCTTTAAAAAAGG - Exonic
959731859 3:109613267-109613289 CTTCTAGAGTTGTTCAAGAAGGG - Intergenic
959741338 3:109723819-109723841 CTTCAATCATTGGTGAAATAAGG + Intergenic
960916041 3:122696074-122696096 ATTGTATCATCATTCAAAAATGG + Intronic
962507116 3:136058743-136058765 CTTGTAGCATTGTTCGAAGATGG - Intronic
964099088 3:152966995-152967017 CAACTATAATTGTTTAAAAAGGG - Intergenic
965172744 3:165288998-165289020 CTTCTAGCATTTTTTAAAATGGG + Intergenic
965185913 3:165463231-165463253 CTTCTATCATTTTTCAAACATGG + Intergenic
965488560 3:169308753-169308775 CTTCTTTCCTTTTTAAAAAAGGG + Intronic
966014572 3:175125672-175125694 CTTCTATTCTTGTACAAAATAGG - Intronic
966542104 3:181103237-181103259 CTTCTAACATTGTTCCCATAAGG - Intergenic
969271134 4:6103429-6103451 CTTGTATCTATGTTCATAAAAGG + Intronic
970072128 4:12172257-12172279 ATTATAACATTGGTCAAAAATGG + Intergenic
970139971 4:12971433-12971455 CTACTACCATTGTTGAACAATGG + Intergenic
970419911 4:15896329-15896351 TTTCTTTCTTTCTTCAAAAAGGG + Intergenic
970986756 4:22167823-22167845 ATTCTGTCATTGTACAAATATGG - Intergenic
972380038 4:38510926-38510948 ATTCTGTCAATGTTAAAAAATGG - Intergenic
972901056 4:43683934-43683956 TTTATATCATTTTTCTAAAAGGG + Intergenic
973946956 4:55967468-55967490 TTTCTCTCAATGTTCAAAGAAGG - Intronic
974325768 4:60413147-60413169 CTTCTATGAATCTTAAAAAATGG - Intergenic
976108748 4:81647513-81647535 TTTCTTTCATTGTTACAAAATGG - Intronic
976365911 4:84231790-84231812 CTTCTGGCATTGGTCAAAATAGG + Intergenic
976951643 4:90839774-90839796 CTTCTCCCATTCTTCTAAAAGGG + Intronic
977328471 4:95606620-95606642 CTTCTCTCACTCTTCACAAAAGG + Intergenic
978366923 4:107991998-107992020 CATCCATCATTGGCCAAAAATGG + Intronic
978369723 4:108018109-108018131 CTTCAAACATTCTACAAAAAGGG + Intronic
978771384 4:112459570-112459592 CTTCTGTCATTCTTCCACAAAGG + Intergenic
980150071 4:129035222-129035244 CTACAATCATAGTTTAAAAATGG + Intronic
980817804 4:137970969-137970991 CTTCTATGATACTTCAAAAGTGG + Intergenic
981319237 4:143372187-143372209 CTTCTACAGTTGTTCAACAATGG - Intronic
982224541 4:153153608-153153630 CTTCTCTCCATCTTCAAAAAGGG - Intronic
982256400 4:153455524-153455546 CTTCTATCATTATTGCTAAAAGG + Intergenic
982558900 4:156904353-156904375 CTTCTAACACTGTTAAAACAGGG + Intronic
983223724 4:165067067-165067089 GTTCTATGATTTTTGAAAAATGG - Intergenic
983993476 4:174151894-174151916 CTTCTATCATTGTTATCAATTGG - Intergenic
986525529 5:8670324-8670346 TTTCTTTCATTGTTCAAAGCAGG + Intergenic
987530159 5:19108021-19108043 CTTCTATAAATGTCCAATAATGG + Intergenic
987811894 5:22847666-22847688 CTTCAATGTTTATTCAAAAAAGG - Intronic
988078003 5:26377768-26377790 CTTGTCACATTCTTCAAAAACGG - Intergenic
988190446 5:27924457-27924479 CTTCAACCATTATTCAAAAATGG - Intergenic
989657979 5:43765443-43765465 CTTCTCTCTTTATTCCAAAAGGG - Intergenic
990033499 5:51291115-51291137 CTTCTACCAGTTTTCACAAAAGG - Intergenic
990455781 5:55986185-55986207 CTTCTATCATTGTTCAAAAAGGG + Intronic
990590609 5:57259500-57259522 CTGCTATCATTGCTTACAAAAGG - Intronic
991096604 5:62746411-62746433 CTGCTATCAGTGCTCAACAATGG + Intergenic
992146042 5:73849503-73849525 CTTCTTTCTTTGTTTAGAAAGGG + Intronic
993156290 5:84228776-84228798 CTTCTATCTCTGTGCAAAACTGG - Intronic
994076709 5:95659948-95659970 ATACTATCAGTGTTCAAAGAAGG - Intronic
994243424 5:97450370-97450392 CTTCTTTCATTGTTCACAGATGG + Intergenic
995300073 5:110569620-110569642 CTTCTATCTTTATTCAAGAAGGG - Intronic
996047726 5:118894191-118894213 CTTCTATCAGAGTTTAAAAGTGG - Intronic
998707162 5:144775862-144775884 GTTTTATCATTGTTTAAAACAGG + Intergenic
998739403 5:145181693-145181715 CTTTTATAATGGTTAAAAAAAGG + Intergenic
999731063 5:154477016-154477038 CTTCCATCATTGTATAAATAGGG - Intronic
999755106 5:154658438-154658460 CATCTAGCTTTGTTCACAAAGGG - Intergenic
999811644 5:155132918-155132940 CTTCCTTGATTGTTCAAAAATGG + Intergenic
1000964899 5:167644612-167644634 CTTCTACCATTGTTCCCATATGG + Intronic
1001518358 5:172373152-172373174 CATCTGTCATTGCCCAAAAAGGG + Intronic
1002886328 6:1298166-1298188 ATTCTAGAATTGTTCTAAAAAGG + Intergenic
1002964751 6:1952801-1952823 CTTCTCTCAGTGTTTAAGAATGG - Intronic
1003986349 6:11439139-11439161 TTCCTATCATTGTTCCAAGAAGG - Intergenic
1004323310 6:14650247-14650269 CTGCTATTATCTTTCAAAAAAGG + Intergenic
1004332157 6:14731722-14731744 CTTGTATCATTTTTTAAAATTGG + Intergenic
1006280697 6:33050776-33050798 CTTTTATAAATGTTCAACAAGGG + Intergenic
1007497684 6:42272266-42272288 TTTCTCTCATAGTTCAGAAAGGG - Intronic
1008047075 6:46862311-46862333 CTTCTGTCAATGTAAAAAAATGG - Intronic
1008135867 6:47776320-47776342 CTTTTTTAATTGTTTAAAAATGG - Intergenic
1009041673 6:58187405-58187427 CTTCTAACTTTATTGAAAAAAGG + Intergenic
1009217526 6:60941720-60941742 CTTCTAACTTTATTGAAAAAAGG + Intergenic
1009490031 6:64278668-64278690 CTTCTAACAATGTTAAAAACTGG - Intronic
1009936478 6:70240596-70240618 CTTCTAACACAGTTCAAAATTGG - Intronic
1010645357 6:78381225-78381247 GTTCTTTCTTTGTTCAGAAATGG + Intergenic
1013680537 6:112520866-112520888 CTTCAAACAATGTTCAAATAAGG - Intergenic
1014646279 6:123976976-123976998 CTTTTTTGATTGTTCAAAACTGG - Intronic
1015513596 6:134063214-134063236 CTTCTATCCTTATTTAGAAAGGG - Intergenic
1015905204 6:138109416-138109438 CCTCTTTCAATGTTCAAAAGTGG - Intergenic
1016323000 6:142868225-142868247 CTTCAATCCTTTATCAAAAATGG + Intronic
1017585670 6:155919840-155919862 CTTCTATCCTTCTTCATAAGTGG + Intergenic
1018002724 6:159594018-159594040 CTTCAATAATTATTCAAATATGG - Intergenic
1018003874 6:159602684-159602706 CTTCTCTCATGCTTTAAAAACGG - Intergenic
1018548581 6:164965749-164965771 CTTCTTTCAAAATTCAAAAAAGG - Intergenic
1020386700 7:7613759-7613781 TTTCTTCCATTCTTCAAAAATGG + Intergenic
1020516150 7:9122246-9122268 ATTCTATTCTTTTTCAAAAAAGG - Intergenic
1020666717 7:11053500-11053522 TTTCTATAATTGTTTGAAAATGG + Intronic
1022311413 7:29200012-29200034 CTTCCACCATTGTGCAAAAATGG - Intronic
1025291885 7:57734291-57734313 CTTATAACAATGTTCACAAATGG - Intergenic
1025570684 7:62560620-62560642 CTTCTACCATTGGCCTAAAAGGG + Intergenic
1025799372 7:64770692-64770714 CCTCTATTAATGTTCAAAATAGG - Intergenic
1026409418 7:70104091-70104113 CTTCTACCATTGTGCCAACATGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030515752 7:110535519-110535541 CTTCTTTCACTTTTTAAAAATGG - Intergenic
1032753870 7:134869725-134869747 TTTCACTCTTTGTTCAAAAAGGG + Intronic
1032957955 7:136994640-136994662 CGTCTTTCTTTGTTGAAAAAGGG - Intronic
1033681776 7:143602382-143602404 CCTCTCTCATTGTTCAGATATGG - Intergenic
1033703113 7:143859531-143859553 CCTCTCTCATTGTTCAGATATGG + Intronic
1034326939 7:150245076-150245098 CTTCACTCATTGTTGAAAGAGGG - Intronic
1034766268 7:153724375-153724397 CTTCACTCATTGTTGAAAGAGGG + Intergenic
1036442069 8:8790075-8790097 CTTAGATCCTTGTTCAAAAAAGG - Intronic
1037310963 8:17556095-17556117 CTTCTAACATAGTTTAAGAAAGG - Intronic
1037554746 8:20011333-20011355 CTTCTATCATTAGTGAAAATGGG + Intergenic
1038336506 8:26649935-26649957 CATCTATCATTTTTAAAAGATGG - Intronic
1042566002 8:70112733-70112755 CTTATATTATTTTTTAAAAAAGG + Exonic
1042867886 8:73371479-73371501 CATCTATCAGTGTTAAAACATGG - Intergenic
1043626485 8:82267069-82267091 CTTAGCTCCTTGTTCAAAAATGG + Intergenic
1043864230 8:85357520-85357542 CTGCTATCATTGTTCATGAGAGG + Intronic
1045315075 8:101036841-101036863 CTTCTATCATTGTAGAAAAAGGG - Intergenic
1046123771 8:109879029-109879051 ATTCTATCATTTTTCCAAGAAGG - Intergenic
1047042353 8:121010004-121010026 CTTTGTACATTGTTCAAAAAAGG + Intergenic
1047921780 8:129642451-129642473 ATTCTACCATTGTTAGAAAAGGG - Intergenic
1050302641 9:4274974-4274996 CGTCTTTCATTATTCAAATAAGG + Intronic
1051221377 9:14851798-14851820 CTTGTTTAATTGTTCCAAAAAGG + Intronic
1051324994 9:15956644-15956666 CTTAGATCATTTTTCAAAAAAGG + Intronic
1052343348 9:27384296-27384318 CTACTATCATTTTTCATGAATGG + Intronic
1052845571 9:33333197-33333219 CTTCCATCACTTTTCCAAAAAGG - Intronic
1053493572 9:38530944-38530966 CATTTATAATTGCTCAAAAAAGG + Intergenic
1055175736 9:73315191-73315213 CTTCTTTCATTGTTTAATTAAGG - Intergenic
1055219742 9:73914504-73914526 CTTTTATCAATGTTCAAAACAGG + Intergenic
1055638025 9:78296931-78296953 CTCCTTGCATTGATCAAAAATGG + Intergenic
1056708422 9:88970809-88970831 CTTATACCATTCTTTAAAAAAGG + Intergenic
1057072653 9:92113544-92113566 CTACTGTCAGTCTTCAAAAAGGG + Intronic
1203404263 Un_KI270515v1:1230-1252 TTTCTACCATAGGTCAAAAAGGG - Intergenic
1186142564 X:6591732-6591754 GTTCTATCATTCTTCAAACATGG - Intergenic
1189067869 X:37830478-37830500 TTTTCATCATTGTGCAAAAATGG - Intronic
1190500562 X:51073292-51073314 CCTCTATCATTTTTAAAAATCGG - Intergenic
1194903916 X:99549718-99549740 CTTCTATCACTGTGGAAATAAGG + Intergenic
1196204202 X:112920344-112920366 CTTTTATCATTGTGCTAACACGG - Intergenic
1200304614 X:155011828-155011850 CCTCTATCATTCTGCAAAAATGG + Intronic