ID: 990458520

View in Genome Browser
Species Human (GRCh38)
Location 5:56012278-56012300
Sequence AAGGTGGCAGGCTGCGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990458514_990458520 5 Left 990458514 5:56012250-56012272 CCTAGCTTTGTGTATTACTATGA No data
Right 990458520 5:56012278-56012300 AAGGTGGCAGGCTGCGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990458520 Original CRISPR AAGGTGGCAGGCTGCGGAGG TGG Intergenic
No off target data available for this crispr