ID: 990458972

View in Genome Browser
Species Human (GRCh38)
Location 5:56014874-56014896
Sequence GGGGGTGTCAGCCCCATGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990458972_990458989 12 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458989 5:56014909-56014931 GACGGGGCGGCTGGCCGGGTTGG 0: 376
1: 3725
2: 3284
3: 1431
4: 760
990458972_990458976 -5 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458976 5:56014892-56014914 CCCCCACCTCCCTCCTGGACGGG 0: 416
1: 5238
2: 2718
3: 829
4: 706
990458972_990458981 -1 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458981 5:56014896-56014918 CACCTCCCTCCTGGACGGGGCGG 0: 298
1: 4617
2: 2969
3: 1015
4: 897
990458972_990458992 15 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458992 5:56014912-56014934 GGGGCGGCTGGCCGGGTTGGGGG 0: 17
1: 421
2: 3952
3: 4371
4: 2147
990458972_990458983 3 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458983 5:56014900-56014922 TCCCTCCTGGACGGGGCGGCTGG 0: 229
1: 3950
2: 2911
3: 2929
4: 2516
990458972_990458986 7 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458986 5:56014904-56014926 TCCTGGACGGGGCGGCTGGCCGG 0: 289
1: 5163
2: 4134
3: 2236
4: 2354
990458972_990458990 13 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458990 5:56014910-56014932 ACGGGGCGGCTGGCCGGGTTGGG 0: 14
1: 404
2: 3756
3: 3307
4: 1519
990458972_990458991 14 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458991 5:56014911-56014933 CGGGGCGGCTGGCCGGGTTGGGG 0: 14
1: 420
2: 5511
3: 4203
4: 1978
990458972_990458973 -10 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458973 5:56014887-56014909 TGACACCCCCACCTCCCTCCTGG 0: 132
1: 3386
2: 1683
3: 463
4: 2372
990458972_990458988 8 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458988 5:56014905-56014927 CCTGGACGGGGCGGCTGGCCGGG 0: 308
1: 5675
2: 4388
3: 1654
4: 769
990458972_990458978 -4 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458978 5:56014893-56014915 CCCCACCTCCCTCCTGGACGGGG 0: 368
1: 4801
2: 3102
3: 913
4: 541
990458972_990458974 -6 Left 990458972 5:56014874-56014896 CCGGACATGGGGCTGACACCCCC No data
Right 990458974 5:56014891-56014913 ACCCCCACCTCCCTCCTGGACGG 0: 33
1: 945
2: 5380
3: 1989
4: 865

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990458972 Original CRISPR GGGGGTGTCAGCCCCATGTC CGG (reversed) Intergenic
No off target data available for this crispr