ID: 990466847

View in Genome Browser
Species Human (GRCh38)
Location 5:56078875-56078897
Sequence CTGATTTCCTGGGGCACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990466847_990466852 -9 Left 990466847 5:56078875-56078897 CCTGAGGTGCCCCAGGAAATCAG No data
Right 990466852 5:56078889-56078911 GGAAATCAGCCAGGAAAAGCAGG No data
990466847_990466859 23 Left 990466847 5:56078875-56078897 CCTGAGGTGCCCCAGGAAATCAG No data
Right 990466859 5:56078921-56078943 TTCATTTCATAGGTTAGGGAGGG No data
990466847_990466863 29 Left 990466847 5:56078875-56078897 CCTGAGGTGCCCCAGGAAATCAG No data
Right 990466863 5:56078927-56078949 TCATAGGTTAGGGAGGGGGTGGG No data
990466847_990466856 18 Left 990466847 5:56078875-56078897 CCTGAGGTGCCCCAGGAAATCAG No data
Right 990466856 5:56078916-56078938 TACTTTTCATTTCATAGGTTAGG No data
990466847_990466857 19 Left 990466847 5:56078875-56078897 CCTGAGGTGCCCCAGGAAATCAG No data
Right 990466857 5:56078917-56078939 ACTTTTCATTTCATAGGTTAGGG No data
990466847_990466858 22 Left 990466847 5:56078875-56078897 CCTGAGGTGCCCCAGGAAATCAG No data
Right 990466858 5:56078920-56078942 TTTCATTTCATAGGTTAGGGAGG No data
990466847_990466853 -8 Left 990466847 5:56078875-56078897 CCTGAGGTGCCCCAGGAAATCAG No data
Right 990466853 5:56078890-56078912 GAAATCAGCCAGGAAAAGCAGGG No data
990466847_990466860 24 Left 990466847 5:56078875-56078897 CCTGAGGTGCCCCAGGAAATCAG No data
Right 990466860 5:56078922-56078944 TCATTTCATAGGTTAGGGAGGGG No data
990466847_990466855 13 Left 990466847 5:56078875-56078897 CCTGAGGTGCCCCAGGAAATCAG No data
Right 990466855 5:56078911-56078933 GGATCTACTTTTCATTTCATAGG No data
990466847_990466861 25 Left 990466847 5:56078875-56078897 CCTGAGGTGCCCCAGGAAATCAG No data
Right 990466861 5:56078923-56078945 CATTTCATAGGTTAGGGAGGGGG No data
990466847_990466862 28 Left 990466847 5:56078875-56078897 CCTGAGGTGCCCCAGGAAATCAG No data
Right 990466862 5:56078926-56078948 TTCATAGGTTAGGGAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990466847 Original CRISPR CTGATTTCCTGGGGCACCTC AGG (reversed) Intergenic
No off target data available for this crispr