ID: 990469340

View in Genome Browser
Species Human (GRCh38)
Location 5:56099460-56099482
Sequence AACTGCCTATTCAACTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990469340 Original CRISPR AACTGCCTATTCAACTCTGT TGG Intergenic
908444289 1:64187169-64187191 AAATGCCCATCCAACTCTGCGGG - Intergenic
911296983 1:96129555-96129577 AACTGCATTTTCTACTGTGTTGG + Intergenic
911408990 1:97478119-97478141 ACCTGGTTATTCAACTCTGAAGG - Intronic
912020363 1:105101640-105101662 AACTGCCTTGTCATCTCTGGTGG + Intergenic
912420208 1:109537575-109537597 AACTGCTTATTCTAGCCTGTGGG - Intergenic
916845956 1:168650228-168650250 AACTGCCTCTTCTACTCTGTAGG - Intergenic
917553736 1:176062330-176062352 AATTGTCTATTCAAATCTTTTGG - Intronic
924664198 1:246053527-246053549 AATTGCCTTTTCATCTTTGTTGG - Intronic
1063952329 10:11234836-11234858 AAGTGCCTTTTTAACTCTGCAGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065430752 10:25652941-25652963 ATCTGCCAATTCAGCTCTGCAGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066477219 10:35759471-35759493 AAGGGCCTATTCAAATATGTGGG - Intergenic
1067727245 10:48779521-48779543 AACTGCCTATCCAACTCTCTGGG + Intronic
1069461958 10:68603978-68604000 AACTTCCTATTCAAGCCTATTGG + Intronic
1070259193 10:74837912-74837934 TTCTGCCTAATTAACTCTGTTGG + Intronic
1071185680 10:83041805-83041827 AACTGCGTATTTAACCCTGGTGG + Intergenic
1071309583 10:84329414-84329436 AATTGCATATTCATCTGTGTGGG + Intronic
1071925854 10:90408467-90408489 GACAGCCTATTTGACTCTGTGGG - Intergenic
1073518961 10:104107250-104107272 AAGTGCCTATTCAATTCTCTTGG + Intergenic
1073537351 10:104289766-104289788 AAATGTCTATTCAAGTCTTTTGG - Intronic
1073823028 10:107287071-107287093 AAATGTCTATTCAAATCTTTTGG + Intergenic
1074661559 10:115664188-115664210 AACTCCCTATACCAATCTGTAGG + Intronic
1077167092 11:1148614-1148636 AATAGCCCATTCAGCTCTGTGGG - Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1078411023 11:11118311-11118333 AATTACATATTCAACCCTGTAGG - Intergenic
1079837664 11:25354307-25354329 AACTGACTCTTAATCTCTGTTGG + Intergenic
1081279062 11:41185817-41185839 AATTGTGTATTCAAATCTGTTGG - Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085342842 11:75744675-75744697 ACCTGCCTATGCAACTCTCCTGG + Intergenic
1087561966 11:99802341-99802363 AACTGCCTGATTAACTCTGGAGG + Intronic
1087958683 11:104321353-104321375 AACTGTGTATCCAACTCTGGTGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1095309153 12:40676079-40676101 AACTACCTATTACAATCTGTGGG - Intergenic
1096509006 12:52116856-52116878 AACGGCCTATGGAACTCTGGGGG - Intergenic
1096858729 12:54506754-54506776 AAGTGCCTGTTCAAATCTTTTGG + Intronic
1099271511 12:80516435-80516457 AAATGTTTATTAAACTCTGTGGG + Intronic
1106541680 13:30696382-30696404 AACTGCCTGCTCAGCACTGTGGG - Intergenic
1106816155 13:33409612-33409634 TACTGCCTTTTCTACTCTGTTGG + Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1112940116 13:104851635-104851657 AACTGCCTTTTATACTCAGTAGG + Intergenic
1113085312 13:106564131-106564153 AACTGCCTATTCAAAATTGAGGG + Intronic
1114209061 14:20600463-20600485 AAATGCCCATCCAACTCTGCTGG - Intronic
1117493978 14:56283461-56283483 AACTGCCTTTTCCACTGTGCTGG - Intronic
1118383114 14:65234070-65234092 AAATGCCCATTCAAGTCTTTTGG + Intergenic
1119138795 14:72245746-72245768 AACTGCTTCTTCAAGTCTGTTGG - Intronic
1123958009 15:25360481-25360503 AACTGCTTCTTCAAGTCTGCAGG + Exonic
1128859487 15:71054206-71054228 AACATCCTATTCATCTCTTTGGG + Intergenic
1131561226 15:93442208-93442230 GACTGCCTTTTCCCCTCTGTCGG - Intergenic
1135182100 16:20284171-20284193 AAATGTCTATTCAAATCTTTTGG - Intergenic
1139014356 16:62671830-62671852 CTATGCCTATTCAACTCTATTGG + Intergenic
1140301926 16:73766367-73766389 GACTGCCTATACATCTCTCTTGG + Intergenic
1142351371 16:89582315-89582337 AAGTGCTTATTAAACGCTGTTGG + Intronic
1144323804 17:14157524-14157546 ACCTGCCTGTTCATCTCTATGGG + Intronic
1145683877 17:26634643-26634665 AAATGAATCTTCAACTCTGTGGG - Intergenic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1146605972 17:34257927-34257949 AAGTTACTACTCAACTCTGTAGG + Intergenic
1148002949 17:44400762-44400784 AACTGCCTTTTTTACTCTCTGGG + Exonic
1148197089 17:45721887-45721909 AGCTGCCTATACAACTCTGTAGG + Intergenic
1151878678 17:76881601-76881623 ATTTGCCCATTCAACTCTCTAGG - Intronic
1153527033 18:6006760-6006782 AACTTCCTATTCTGCTCTGTTGG - Intronic
1153749886 18:8218529-8218551 AACTGTCTATTAACTTCTGTAGG + Intronic
1155786206 18:29903768-29903790 AAGTGTCTATTCAAATCTTTTGG + Intergenic
1156794037 18:41018808-41018830 AGCTGCCTATTCTATTCTGATGG - Intergenic
1156997187 18:43482458-43482480 AAATGCCCATCCAACTCTGCCGG - Intergenic
1157038361 18:44005738-44005760 AAATGTCTATTCAAGTCTTTTGG - Intergenic
1157367960 18:47083850-47083872 AAATACCTATTTAACTCTCTGGG + Intronic
1158111434 18:53944419-53944441 AAATGCCCATTTAACTCTGCCGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1164996965 19:32728095-32728117 GACTCTCTATTCTACTCTGTTGG + Intronic
1166614851 19:44234222-44234244 AACTGCCTTCCCAAATCTGTTGG + Intronic
1167947121 19:52997217-52997239 AACTGCCTATTGCACACTGGAGG - Intergenic
925096631 2:1209586-1209608 AAATGCCACTTAAACTCTGTGGG + Intronic
926571104 2:14530749-14530771 AAATGCTTATTCAACTTTGTTGG - Intergenic
927648930 2:24899142-24899164 AACTGCCTAGGCAACTCCCTAGG + Intronic
928854478 2:35788251-35788273 AAATGCCCATCCAACTCTGCAGG - Intergenic
929454761 2:42057926-42057948 GACTGCCTCTCCAACCCTGTGGG + Exonic
930348220 2:50213800-50213822 AACTTCTTGTTCAACTCTGAAGG + Intronic
932246624 2:70202130-70202152 AAATGCCCATCCAACTCTGCTGG - Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932747133 2:74343261-74343283 ATCTGCCTATTCTATTCAGTTGG + Intronic
933090646 2:78111840-78111862 AAATGTCTATTCAACTCTTCTGG + Intergenic
937183951 2:120021654-120021676 AACTGTCTTTCCAATTCTGTAGG + Intronic
939057347 2:137381309-137381331 AAATGCCCATCCAACTCTGCTGG - Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
942217867 2:173739968-173739990 AACTGCAAATTCAGCTCTATAGG - Intergenic
943398118 2:187367895-187367917 AACTGCCTCTGTAACTCTGCTGG - Intronic
943436999 2:187877655-187877677 CACTTCCTTTTCTACTCTGTTGG + Intergenic
943722294 2:191217757-191217779 AACTGCTTAGTCACCTCTGGTGG + Intergenic
944392332 2:199229847-199229869 AAATGCCCATCCAACTCTGCTGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947964871 2:234271292-234271314 AAGTACCTATTCAAGTCTTTCGG - Intergenic
948814799 2:240504604-240504626 AAATGTCTATTCAACTCCTTTGG - Intronic
948967943 2:241399200-241399222 AAGTGCCTATTTAAGTCTTTCGG + Intronic
1169923690 20:10760816-10760838 AACTGCCTATGCATATCTTTTGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172980302 20:38936582-38936604 AACTGCCCATTAAACTTGGTTGG + Intronic
1173639772 20:44592759-44592781 AACTGCCTGTTCAACTAGGCAGG - Intronic
1177693952 21:24547462-24547484 AACTGCCTCTGCAACTTTTTAGG - Intergenic
1182409991 22:30176600-30176622 CACATCCTATGCAACTCTGTGGG - Exonic
1184263662 22:43334327-43334349 ACCTGACTGTTCACCTCTGTGGG + Intronic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
950089106 3:10282467-10282489 AACTGCACATTCAACTGTGAAGG - Intronic
951797419 3:26555911-26555933 AAATGTCTATTCAAATCTTTTGG - Intergenic
952422647 3:33145504-33145526 AACTTCCTTTTGAACTCAGTGGG + Exonic
953428627 3:42818106-42818128 AGCTATCTATTCAACTGTGTTGG + Intronic
956104177 3:65799511-65799533 AACAGCTTCTTCAACTCTGCTGG - Intronic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
960453087 3:117834669-117834691 ACCTTCCTATTAAACTCAGTGGG - Intergenic
960534652 3:118802778-118802800 AAACGCCTATCCAACTCTGCCGG + Intergenic
962215301 3:133515782-133515804 AGATTCTTATTCAACTCTGTGGG + Intergenic
962357801 3:134709773-134709795 AACTGCTAACTCAGCTCTGTTGG - Intronic
964432379 3:156620918-156620940 AAATGCCCATCCAACTCTGCCGG - Intergenic
964457716 3:156886265-156886287 AACAGCCTCTCCAACTGTGTGGG - Intronic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
971292659 4:25359231-25359253 AAATGCCCATCCAACTCTGCTGG - Intronic
972387320 4:38579884-38579906 AACTGCCTAATGGACTCAGTTGG + Intergenic
980343697 4:131584304-131584326 AAATGCCCATCCAACTCTGCTGG + Intergenic
981535038 4:145790966-145790988 AACTGCCTAATCAAATAGGTAGG - Intronic
983728592 4:170963543-170963565 AACTTCCTAGTCAAGTCAGTTGG - Intergenic
984583708 4:181538932-181538954 AACTGGCTTTTTAATTCTGTTGG + Intergenic
985158216 4:187015531-187015553 CTCTGACTATTCAACTCTTTTGG - Intergenic
986520488 5:8612274-8612296 AAATGTCTATTCAAGTCTTTAGG - Intergenic
988862354 5:35295976-35295998 AAGTGCATATACAACTCTTTAGG + Intergenic
990469340 5:56099460-56099482 AACTGCCTATTCAACTCTGTTGG + Intergenic
997796059 5:136812642-136812664 AATTGTCTATTCATGTCTGTAGG - Intergenic
999862511 5:155663631-155663653 AGCTCCTTATTCTACTCTGTAGG + Intergenic
1002114533 5:176948441-176948463 AAATACCTATTTTACTCTGTTGG - Intronic
1002151503 5:177236342-177236364 AACTACATATTAAACTATGTAGG - Intronic
1006709620 6:36056220-36056242 AATTGTCTATTCAACTGTGTGGG + Intronic
1008172151 6:48221368-48221390 AACTGAAAATTCAACTTTGTTGG - Intergenic
1008306119 6:49902223-49902245 GACTGTCTTTTAAACTCTGTGGG + Intergenic
1009783919 6:68306285-68306307 AAATGTCTATTCAAATCTTTTGG - Intergenic
1009909219 6:69904919-69904941 AAATGCCCATCCAACTCTGCTGG + Intronic
1010240449 6:73610912-73610934 AACTGAATAATAAACTCTGTTGG + Intronic
1012417502 6:99025867-99025889 AAATGCCCATCCAACTCTGCAGG + Intergenic
1013434899 6:110093835-110093857 ATCTGCCTAATTTACTCTGTGGG - Intergenic
1013631580 6:111991319-111991341 GAATGCCTATTAACCTCTGTAGG + Intergenic
1015060098 6:128953048-128953070 AAGTCCCTATTAATCTCTGTTGG + Intronic
1015079351 6:129204862-129204884 AACTGCTCATTCATTTCTGTTGG - Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1022309331 7:29180973-29180995 AACTGCCTATTCATCTCTTTTGG - Intronic
1027400753 7:77803820-77803842 AAATGATTATTCAACTCTGCCGG - Intronic
1027617421 7:80440790-80440812 AACTGCCTGCTCAACTCTACTGG + Intronic
1027659158 7:80968131-80968153 AATTGCCTAATCACCTCAGTGGG + Intergenic
1027684847 7:81267215-81267237 AAATGCCCATCCAACTCTGCCGG + Intergenic
1028319085 7:89437959-89437981 AAATGCCCATCCAACTCTGCTGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1031472726 7:122186495-122186517 AAATGTCTATTCAAATCTTTTGG - Intergenic
1035851253 8:2921366-2921388 AACTGCATCCTCAACTTTGTGGG - Intergenic
1035924899 8:3716779-3716801 AACTTTCCATTTAACTCTGTTGG + Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036775613 8:11610526-11610548 AAATGCCTATTCAAATCCTTCGG - Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1041154131 8:54966647-54966669 AAATGCATAGTCAACTCTCTGGG - Intergenic
1041766064 8:61419480-61419502 AAATGCATCTTCAACTCTCTTGG - Intronic
1042156088 8:65845479-65845501 TTCTGCCTATTCAAGTCTGCTGG + Intergenic
1042490886 8:69395891-69395913 AACAGTATTTTCAACTCTGTGGG + Intergenic
1044624249 8:94220719-94220741 AACTGCCTGTTCAACTGCATTGG + Intergenic
1046984094 8:120368554-120368576 GAATGCCTTTTCAACACTGTTGG + Intronic
1052126081 9:24775950-24775972 AACTGCCAATGTACCTCTGTGGG - Intergenic
1056865849 9:90226845-90226867 GCCTGCCTATTGAACTCTGGGGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057979310 9:99642887-99642909 AAATGTCTATTCAACTCCTTTGG - Intergenic
1058345481 9:103955970-103955992 ATGTGTCTATTCAACTCTGTAGG - Intergenic
1059208724 9:112490677-112490699 AAAAGCCTATTAAACTTTGTTGG - Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1186340376 X:8639284-8639306 AGCTGCCTATTTAAATTTGTGGG - Intronic
1187116551 X:16358105-16358127 AAATGTCTATTCAGCTCTTTTGG + Intergenic
1189389834 X:40567027-40567049 AACTGACTTTTCACCTCTCTGGG - Intergenic
1189573498 X:42324963-42324985 TACTGCTTGTTCAACGCTGTGGG + Intergenic
1190151651 X:47954928-47954950 AACTGGCAATTCAACTCCATTGG - Intronic
1190161043 X:48031507-48031529 AACTGGCAATTCAACTCCATTGG + Intronic
1190374015 X:49771277-49771299 AAATGCCTATTCAAATCTTTTGG + Intergenic
1192275239 X:69623025-69623047 AACTGTTTATTCTATTCTGTTGG + Intronic
1192863365 X:75103447-75103469 GACTCCCTATTCTGCTCTGTTGG + Intronic
1194403458 X:93465973-93465995 AACTGACTAATCAAATCTCTGGG - Intergenic
1195813968 X:108865299-108865321 AAATGCCTATTCAGATCTTTTGG + Intergenic
1197468875 X:126841748-126841770 AAATGACTATTCAAATCTTTGGG - Intergenic
1198797781 X:140417254-140417276 TACTACCTATTCTACTCTATGGG + Intergenic
1199622084 X:149711220-149711242 AACTGCCTATTTCACTCTAATGG - Intronic
1201794960 Y:17885862-17885884 TAATGACTATTCACCTCTGTCGG + Intergenic
1201806595 Y:18020119-18020141 TAATGACTATTCACCTCTGTTGG - Intergenic
1201951095 Y:19565070-19565092 AAATGCCTATTCAAATCTTTTGG - Intergenic