ID: 990481915

View in Genome Browser
Species Human (GRCh38)
Location 5:56220015-56220037
Sequence CTCCGGTGCAGCAGGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990481915_990481920 -10 Left 990481915 5:56220015-56220037 CCCAGCTGCCTGCTGCACCGGAG 0: 1
1: 0
2: 1
3: 24
4: 158
Right 990481920 5:56220028-56220050 TGCACCGGAGGCTGAGCTGAGGG No data
990481915_990481925 24 Left 990481915 5:56220015-56220037 CCCAGCTGCCTGCTGCACCGGAG 0: 1
1: 0
2: 1
3: 24
4: 158
Right 990481925 5:56220062-56220084 AAGCTGATCCAATGAGTTGTGGG No data
990481915_990481924 23 Left 990481915 5:56220015-56220037 CCCAGCTGCCTGCTGCACCGGAG 0: 1
1: 0
2: 1
3: 24
4: 158
Right 990481924 5:56220061-56220083 GAAGCTGATCCAATGAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990481915 Original CRISPR CTCCGGTGCAGCAGGCAGCT GGG (reversed) Intronic