ID: 990481920

View in Genome Browser
Species Human (GRCh38)
Location 5:56220028-56220050
Sequence TGCACCGGAGGCTGAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990481915_990481920 -10 Left 990481915 5:56220015-56220037 CCCAGCTGCCTGCTGCACCGGAG 0: 1
1: 0
2: 1
3: 24
4: 158
Right 990481920 5:56220028-56220050 TGCACCGGAGGCTGAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990481920 Original CRISPR TGCACCGGAGGCTGAGCTGA GGG Intronic