ID: 990482975

View in Genome Browser
Species Human (GRCh38)
Location 5:56229551-56229573
Sequence TTGTGCAAGTTCATGTAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990482974_990482975 -4 Left 990482974 5:56229532-56229554 CCAGTGGAGATCAACTAGTTTGT 0: 1
1: 0
2: 0
3: 12
4: 77
Right 990482975 5:56229551-56229573 TTGTGCAAGTTCATGTAACTAGG 0: 1
1: 0
2: 1
3: 23
4: 163
990482972_990482975 23 Left 990482972 5:56229505-56229527 CCACATTTACAGTCAAGGAGACA 0: 1
1: 0
2: 2
3: 43
4: 332
Right 990482975 5:56229551-56229573 TTGTGCAAGTTCATGTAACTAGG 0: 1
1: 0
2: 1
3: 23
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990482975 Original CRISPR TTGTGCAAGTTCATGTAACT AGG Intronic
904222357 1:28982588-28982610 ATGGGCAAGTTCATGAAACCTGG - Intronic
904935014 1:34123870-34123892 TTGTCCAAGGTCATACAACTAGG + Intronic
905221862 1:36453421-36453443 TTGTCCAAATTCATATAGCTGGG - Intergenic
906583933 1:46959228-46959250 TTGTTCAAGTTCATGAACATGGG - Intergenic
908016984 1:59852204-59852226 TTGGGAAAGTTCATGAAAATTGG + Intronic
909330879 1:74409197-74409219 TTGCCCAAGGTCATGTAACTAGG + Intronic
910446977 1:87308795-87308817 TTGTTCAAGGTCATTTAATTAGG - Intergenic
918016799 1:180642580-180642602 TTGCCCAAGGTCATGTAGCTAGG + Intronic
919510590 1:198459118-198459140 TTGCTGAAGTTAATGTAACTTGG + Intergenic
920266553 1:204728185-204728207 TTGTTCAAGTTCATCTAGATCGG + Intergenic
921285332 1:213604470-213604492 TGGTGCCTGTTCTTGTAACTGGG + Intergenic
1064022648 10:11822410-11822432 TGGTGGAAGTTAATGTTACTGGG - Intergenic
1068255721 10:54508098-54508120 TTTCCCAAGATCATGTAACTAGG + Intronic
1070259422 10:74840167-74840189 TTGAGGAAGTTCCTGTAATTTGG + Intronic
1070377335 10:75845755-75845777 TTGTTGAATTTCCTGTAACTTGG + Intronic
1072293312 10:93986759-93986781 TTGTAAATGTTCATGAAACTTGG + Intergenic
1072900576 10:99403394-99403416 TTGTCCCAGTACATTTAACTGGG - Intronic
1073479659 10:103778502-103778524 TTGGCCAAGGTCATGTAGCTAGG - Intronic
1073982416 10:109169556-109169578 CTGTGTAAGTTAATGTAAGTTGG - Intergenic
1076113507 10:127879486-127879508 TTGTTCAAGTTCATCTAGCTGGG - Intronic
1080177436 11:29382460-29382482 TTGTGTTATTTCATATAACTGGG - Intergenic
1080292183 11:30683315-30683337 ATGTGTGAGTTCATGGAACTAGG + Intergenic
1080441988 11:32303213-32303235 GTGTGCAAGTTAATATAGCTTGG - Intergenic
1081360354 11:42169727-42169749 TTCTGCAAGTTCTTAAAACTGGG + Intergenic
1082230572 11:49760910-49760932 TTGTCTAAGGTCATGTATCTAGG + Intergenic
1083907497 11:65682793-65682815 CAGGGCAAGTTCATCTAACTAGG - Intergenic
1085178234 11:74509299-74509321 TTGTGCAAGCTCCTCAAACTAGG - Intronic
1085434643 11:76489261-76489283 CTGTGCATGTCCATGTTACTTGG + Intronic
1086619481 11:88868060-88868082 TTGTCTAAGGTCATGTATCTAGG - Intronic
1086929816 11:92680818-92680840 TTGCCCAAGGTCATTTAACTGGG + Intronic
1087430613 11:98048428-98048450 TTGTGAAAGTTCATATGGCTGGG + Intergenic
1087728088 11:101745750-101745772 TTGCAAAAGTTCCTGTAACTAGG + Intronic
1090534040 11:127620848-127620870 TTGCCCAAGTTTACGTAACTAGG - Intergenic
1091166449 11:133480331-133480353 TTGTCCTTGTTCATGTAACCTGG + Intronic
1092520048 12:9261839-9261861 TTATCCAAGGTCATGTATCTAGG + Intergenic
1093499003 12:19789273-19789295 TTGTTCAAATTCATTTAACTAGG + Intergenic
1096897012 12:54831338-54831360 TCTTTCAAGTTCATGTGACTTGG + Intronic
1099149650 12:79094326-79094348 CTTTTCAAGTTCATGTGACTTGG - Intronic
1100829605 12:98505765-98505787 TGGGGTAAGTTCATGTTACTTGG + Intergenic
1102256257 12:111417018-111417040 TTATGTATGTTCATGTAAATGGG + Intronic
1102273184 12:111557895-111557917 TTGTTCAAGGTTTTGTAACTTGG - Intronic
1103824020 12:123721617-123721639 ATGGGCAAGTTCATGAAACCTGG - Intronic
1106951470 13:34889219-34889241 TTGTGTAAGTTCAGGAATCTAGG - Intergenic
1108157134 13:47596911-47596933 TTGTGCAGGTTCATTTGAGTTGG + Intergenic
1111085142 13:83366054-83366076 TTGTGAAAGTTCATGTAACATGG - Intergenic
1111942900 13:94631754-94631776 TTGTTCAATTGCATGGAACTTGG + Exonic
1112244129 13:97713830-97713852 TTTTTCAAGTTCATGTGACCTGG + Intergenic
1112605048 13:100896301-100896323 TTGCCCAAGTTCATGCAACCAGG - Intergenic
1114357863 14:21933219-21933241 TTGTGCAAGCTCATTTAATTTGG + Intergenic
1114568892 14:23652083-23652105 TTGTCCCATTTCAGGTAACTTGG + Intergenic
1114788274 14:25625961-25625983 TTGTGCAGATTCATTTAATTTGG - Intergenic
1114917166 14:27283140-27283162 ATTTTTAAGTTCATGTAACTTGG + Intergenic
1115497764 14:34023926-34023948 TTGTCTAAAGTCATGTAACTGGG + Intronic
1116560234 14:46369347-46369369 TTGTTCAAGTTCTTGCGACTAGG - Intergenic
1117270186 14:54135654-54135676 TTTTCGAAGTACATGTAACTGGG + Intergenic
1117898079 14:60508353-60508375 TTGTTCAAGTCCATTAAACTGGG + Intronic
1118300718 14:64613529-64613551 TTCTGCAAGCTCATGTAAGTGGG - Intergenic
1120032291 14:79655912-79655934 TTGTGAAAATACATGTTACTGGG + Intronic
1120616266 14:86708979-86709001 TTGTGCAAGGTCATGCAGCTAGG - Intergenic
1122585097 14:102800433-102800455 TTGGTCAAGTTCATGCAGCTGGG - Intronic
1125342155 15:38685781-38685803 TTGCCCAAGGTCATGTAGCTGGG + Intergenic
1127110018 15:55658905-55658927 TTGTGTAAATACATCTAACTGGG - Intronic
1128529631 15:68435504-68435526 ATGTAAAAGGTCATGTAACTAGG + Intergenic
1128722302 15:69959006-69959028 TTGTGCAAGCTTCTGTAAGTTGG + Intergenic
1133643496 16:7740757-7740779 TTGTCCAAGGCCTTGTAACTAGG - Intergenic
1134463550 16:14451549-14451571 TTCTGGAATTTCATGTAAATGGG - Intronic
1139070711 16:63378753-63378775 TTGTCCAAGCTGATGTAACTTGG - Intergenic
1146694998 17:34902272-34902294 TTGTGCAAATTTCTGTAAGTTGG - Intergenic
1147788653 17:42998751-42998773 ATGGGCAAGTTCATGAAACCTGG + Exonic
1153272342 18:3334982-3335004 TTTTTCAAGTTCATGTAATTTGG + Intergenic
1155256403 18:24001720-24001742 TTTTCCAAGTTCATGAAAATTGG + Intronic
1156343221 18:36231390-36231412 TTGTTCAAGTTCAAGTACCCAGG + Intronic
1157277827 18:46324352-46324374 TTGTTCAGGTTTATGGAACTGGG - Intergenic
1158793326 18:60809788-60809810 TTGTGAAAGTTTATGTGACCAGG - Intergenic
1159667142 18:71175527-71175549 TTCTGCAATTTTATGTAATTAGG + Intergenic
1163327278 19:16613140-16613162 TTGTCCAAGGACATATAACTTGG + Intronic
1165864690 19:38929631-38929653 TTGCGCTAGGTCATGCAACTGGG - Intronic
1166603287 19:44117254-44117276 TTGTCCAAGGTCATGTGACCAGG + Intronic
926557268 2:14373682-14373704 TTGGGCAAGTTCATGTCTGTTGG + Intergenic
928085786 2:28345432-28345454 TTGTTCAAGTTCACGCACCTAGG - Intergenic
928187778 2:29129316-29129338 CTTTTCAAGTTCATGTGACTTGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930758225 2:55001632-55001654 TTGTGGAATTTCATGTTAATAGG - Intronic
931227782 2:60348826-60348848 TTTCCCAAGGTCATGTAACTAGG - Intergenic
931572573 2:63684306-63684328 ATGGGCAAGTTCATGAAACCTGG + Intronic
934692727 2:96374171-96374193 TTTTGCAAGTTCCTCTACCTTGG - Intergenic
936378025 2:111959081-111959103 TTTTGCAAGTTCATGCAGCCTGG + Intronic
937851026 2:126636473-126636495 TTGTGCATGTACATGTACCCTGG - Intergenic
939823910 2:146991006-146991028 TTATGCAAATTTATGTAAATTGG - Intergenic
941240654 2:163032763-163032785 ATGTTCAACATCATGTAACTAGG + Intergenic
942810879 2:179999658-179999680 TTCAGCAAGTTCCTCTAACTTGG - Intronic
942876047 2:180799639-180799661 TTTTATAAGTTAATGTAACTTGG + Intergenic
945084977 2:206122018-206122040 TTATACAATTTCAGGTAACTGGG + Intronic
948377231 2:237529525-237529547 TTGAGCAAGTTCATGTTACCGGG + Intronic
1168958792 20:1854031-1854053 TTGTCCAAGATTGTGTAACTAGG - Intergenic
1170695458 20:18653934-18653956 TTGTTCAAGGTCATGTGACATGG + Intronic
1171275938 20:23856458-23856480 TTGTGCATGTACATGTGAGTAGG - Intergenic
1172278752 20:33695633-33695655 CTGTCTAAGTTCATGGAACTTGG - Intergenic
1172585641 20:36082153-36082175 TTGTGCATGTTCATTTCCCTGGG + Intergenic
1173180173 20:40800460-40800482 TTGTCCAAGGTCATGTATGTAGG - Intergenic
1174089679 20:48037168-48037190 TGGTGCCAGATCCTGTAACTGGG + Intergenic
1183006147 22:34904171-34904193 TTGTGCAAATTGCTGTAGCTTGG - Intergenic
949430550 3:3971079-3971101 TTATTCAAGTTAATGTAAGTTGG + Intronic
951131458 3:19050734-19050756 TTTTTCAAGTTCATGTAATCTGG - Intergenic
952006342 3:28846528-28846550 TTGCGCAAGTTTTAGTAACTTGG - Intergenic
952851251 3:37731626-37731648 TTGTGAAAGTTCATTGAGCTGGG - Intronic
952862800 3:37828811-37828833 TTGTTCAAATTCATGTTATTTGG - Intergenic
953110175 3:39928266-39928288 TTCTGCAAGATTATGTAAATTGG - Intronic
957731210 3:84139555-84139577 TTGTGCAAGTTCATGTGAAGAGG + Intergenic
958705795 3:97653546-97653568 TTGTGCATGGTAATGTAAATTGG + Intronic
959764944 3:110014385-110014407 TTATATAAGTACATGTAACTTGG + Intergenic
962919812 3:139940335-139940357 TTGTCCAAGATCATCTAACTAGG - Intronic
963184973 3:142404893-142404915 TTGTACAAGGTAATGTTACTTGG - Exonic
964308777 3:155369985-155370007 TTGTCCAAGGTCATGTAGCAAGG - Intergenic
971057405 4:22929116-22929138 TTGGCCAAGGTCACGTAACTGGG + Intergenic
971748976 4:30621831-30621853 TTGTGCCACTTCATGGAACTAGG - Intergenic
973283497 4:48388596-48388618 TTGTACAAGGCCATATAACTAGG + Intronic
974915129 4:68170168-68170190 TTGTTTAAGTTCATATAGCTTGG + Intergenic
975614816 4:76235573-76235595 TTGTCCAAGATCATGAAGCTAGG + Intronic
981433103 4:144685506-144685528 TTGTGGAATTTCAGTTAACTTGG + Intronic
983252517 4:165360785-165360807 CTGTGCAAGTTCATATAAATAGG - Intergenic
984522284 4:180816555-180816577 TTGAGCAAACTCATGAAACTGGG - Intergenic
987905189 5:24067638-24067660 TTGGTGAAGTTCATGTAACAAGG - Intronic
987978949 5:25054847-25054869 CTCTTCAAGTTCATGTGACTTGG + Intergenic
988571149 5:32367907-32367929 TTGTCCAAGGTCATGTAGCTAGG + Intronic
988734410 5:34006635-34006657 TTGTCCAAGGTCTTGTAATTAGG - Intronic
990482975 5:56229551-56229573 TTGTGCAAGTTCATGTAACTAGG + Intronic
992000883 5:72435206-72435228 TTGTGCAAGTTCATGTTCATGGG + Intergenic
992937385 5:81722614-81722636 ATGCTCAAGGTCATGTAACTAGG - Intronic
992986384 5:82234625-82234647 TTGCCCAAGGTCATTTAACTTGG - Intronic
993433875 5:87866907-87866929 TTGTGCAAGGTGATACAACTTGG + Intergenic
993454973 5:88117259-88117281 TTGTGCTACCTCTTGTAACTTGG - Intergenic
994952413 5:106481141-106481163 ATTTTCAAGTTCATGTAACTTGG - Intergenic
996301618 5:121993556-121993578 TTGTCCAAGGTCCTATAACTGGG - Intronic
1001284740 5:170414705-170414727 TTTTGTAAGTTCCTGAAACTTGG - Intronic
1001290182 5:170451561-170451583 TTTTGCAAGTTCAGGTTTCTGGG - Intronic
1002059469 5:176617980-176618002 TTGTGCAATTTCATGGAGCCAGG - Intergenic
1002796361 6:474137-474159 ATGCCCAAGGTCATGTAACTAGG - Intergenic
1002801548 6:526845-526867 TTGCTCAAGTTCATGTAGCTAGG - Intronic
1006708748 6:36046843-36046865 GTGTGCAAGTTCAATTAACTGGG - Intronic
1006899724 6:37492126-37492148 TTGCCCAAGGTCGTGTAACTGGG + Intronic
1007303949 6:40890151-40890173 TTGTCCAAGATCATTCAACTGGG - Intergenic
1008207583 6:48682053-48682075 TTCTGCAAGTGAATTTAACTTGG - Intergenic
1008833404 6:55797552-55797574 TTATGCACATTCATGTAAATGGG - Intronic
1008845536 6:55958545-55958567 TCATTCCAGTTCATGTAACTTGG + Intergenic
1009796721 6:68478879-68478901 TTGCCCAAGGTCATATAACTAGG + Intergenic
1010994744 6:82520304-82520326 TTGTCCAATTTCACATAACTAGG + Intergenic
1014505966 6:122256711-122256733 TTGTCCCGGTTCATATAACTTGG + Intergenic
1014660460 6:124164558-124164580 TTGTGCAACTTCTTAAAACTTGG - Intronic
1014882609 6:126742270-126742292 TTGTCCAAGTTCATACAGCTAGG - Intergenic
1018942851 6:168320599-168320621 TTCTGGAAGTTCATGGAAATGGG + Intergenic
1020819015 7:12942599-12942621 TTGTGCAAGGTCAAGTTACGAGG - Intergenic
1024026990 7:45419601-45419623 TCGTGCAAGTTCACATATCTTGG - Intergenic
1027136416 7:75627588-75627610 TTGTTCCAGTTGATGTTACTTGG + Intronic
1030104793 7:105978079-105978101 TTGCCCAAGTTCACATAACTAGG + Intronic
1030196504 7:106858570-106858592 TTGTGGAAGTTCATGAAGCTTGG - Intergenic
1031069254 7:117143630-117143652 TTGTTAAAGGTCATGTAACAAGG + Intronic
1031572196 7:123373203-123373225 TTGAGAGAGTTTATGTAACTTGG - Intergenic
1032359550 7:131242592-131242614 ATGGGCAAGTTCATGAAACCTGG + Intronic
1034560913 7:151878458-151878480 TTGTGCAAGCTGCTGGAACTCGG - Intergenic
1037443308 8:18939241-18939263 TTCTGGAAGTTCATGAAGCTGGG + Intronic
1037622902 8:20582251-20582273 GTCTTCTAGTTCATGTAACTTGG - Intergenic
1038011243 8:23477764-23477786 TTGTGCAAGTTCACAGATCTGGG - Intergenic
1038966933 8:32584275-32584297 TTCAGCAAATTCATGTCACTGGG + Intronic
1041250945 8:55934533-55934555 CCGTGCAAGTGCATGCAACTGGG + Intronic
1042151743 8:65794327-65794349 TTGAGGAAGTTCATGTGGCTTGG - Intronic
1043288208 8:78561804-78561826 ATGTGTAAATTCATGTAACATGG + Intronic
1046444199 8:114294864-114294886 ATGTGAAAGTTCATGTGACTTGG + Intergenic
1046751124 8:117927857-117927879 TTGTGCTAGATCCTGTAAATTGG + Intronic
1047717156 8:127606068-127606090 TTATACAAGATCATGCAACTAGG - Intergenic
1047975753 8:130128535-130128557 TTCTGCAAGTCCATGTCAGTGGG + Intronic
1048195484 8:132328511-132328533 TTGCGCCAGCTCAAGTAACTTGG - Intronic
1050977537 9:11960058-11960080 ATGTGCAAACTCATGTAAGTTGG - Intergenic
1052398586 9:27972386-27972408 TTCTGCAAGTTTATTTAACAAGG + Intronic
1053334964 9:37259730-37259752 TTCTGCTATTTCTTGTAACTTGG + Intronic
1055444496 9:76369153-76369175 ATGGGCAATTTCATGTTACTTGG + Intergenic
1056740066 9:89246685-89246707 TTGTGCAAGTCCATGCAACCAGG - Intergenic
1057088323 9:92231865-92231887 CTTTTCAAGTTCATGTGACTTGG + Intronic
1057594774 9:96406164-96406186 GTGTGAAAGTTCACTTAACTGGG - Intronic
1058661206 9:107271024-107271046 CTGTGTAAGTTCAGGTACCTGGG - Intergenic
1187241833 X:17521087-17521109 TTGGGCTCCTTCATGTAACTGGG - Intronic
1188458433 X:30394399-30394421 TTGTGATAGTTCATGTTATTAGG - Intergenic
1190716990 X:53113261-53113283 TTGGGCAAGTTCATGAAACCTGG - Intergenic
1191014482 X:55793808-55793830 TTGGGCAAGATCATGCAGCTGGG + Intergenic
1192323626 X:70113518-70113540 TTTTTCAAGTTTATGTGACTTGG - Intergenic
1196566187 X:117207531-117207553 TTGTTCAAATTCATGTTTCTGGG + Intergenic
1196636265 X:118006424-118006446 TTGTCCAAGTTCATGTAGCAAGG - Intronic
1198599966 X:138271805-138271827 TTGTCCAAGGTCATGCAGCTAGG - Intergenic