ID: 990482995

View in Genome Browser
Species Human (GRCh38)
Location 5:56229697-56229719
Sequence CCACCTCGTTGGAGCCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990482995 Original CRISPR CCACCTCGTTGGAGCCCTGA AGG Intronic
900582142 1:3414584-3414606 AGACCCCGTGGGAGCCCTGAAGG + Exonic
902535179 1:17115597-17115619 CCACCTCTTGTGAGCCCTGGAGG - Intronic
905554640 1:38872888-38872910 CCACCTCGCTGGACCCCGGACGG + Intronic
906581077 1:46935527-46935549 CCACCTGGATGCTGCCCTGATGG + Exonic
906602647 1:47143367-47143389 CCACCTGGATGCTGCCCTGATGG - Exonic
912691867 1:111810684-111810706 CCAGCTCCTTGGAGTCCTGGAGG - Intronic
916634721 1:166656292-166656314 GCACCTCGCTGGAGCCCTCAGGG + Intergenic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
919475663 1:198030625-198030647 CCACCTCTTTGGAGACTTCATGG - Intergenic
1065724972 10:28660606-28660628 CCACTTCGTTCTAGCCCAGAGGG + Intergenic
1067849357 10:49745009-49745031 CCACCTTCATGGAGCTCTGAGGG - Intronic
1068848670 10:61710569-61710591 CCACCTGGTTTCAGCTCTGATGG + Intronic
1068983793 10:63088547-63088569 GCACCTCCATGGAGCACTGAGGG + Intergenic
1069719671 10:70541456-70541478 CCACCTCGGGGAAGCCCTGAGGG - Exonic
1070750450 10:78961075-78961097 CCACCCTATTGAAGCCCTGAGGG + Intergenic
1075113764 10:119608917-119608939 CCACCTCACAGGAGCACTGAAGG + Intergenic
1076667235 10:132100218-132100240 CCACCCCGTTGGAGAACTGTGGG + Intergenic
1076770190 10:132658719-132658741 CAGCCTCCTTGGAGCCCAGAGGG - Intronic
1077006014 11:356358-356380 CCGCCTCGTGGGAGCGCGGACGG - Intergenic
1077282719 11:1752925-1752947 CCACCTTGTTGGAGCCTGCAGGG - Exonic
1077887650 11:6397609-6397631 GCACCTAGTTGGAGCCCTGAAGG - Intronic
1084153656 11:67302661-67302683 CCAGCTCCTTTCAGCCCTGAGGG - Intergenic
1090821558 11:130347039-130347061 CCACCTAGTTGAAGGCCTGAAGG + Intergenic
1090943467 11:131409337-131409359 ACACCTCTTTGTAGCCCAGATGG - Intronic
1091696585 12:2632100-2632122 CCACCTCCTGGAAGCCCAGAGGG + Intronic
1091712144 12:2749651-2749673 CCACCTCCATGGAGCCCAGCAGG + Intergenic
1095743612 12:45633458-45633480 CTCCCTCGATGGAGCCCAGAGGG - Intergenic
1104637638 12:130448010-130448032 CCACCTCTTAGGGGCTCTGAGGG + Intronic
1108111403 13:47077493-47077515 CAACCTCGTAGGAGATCTGATGG - Intergenic
1111572544 13:90106264-90106286 CCAACCAGTTGGAGCCCTGGGGG - Intergenic
1112278097 13:98039427-98039449 CCACATCCCTGGAGCCCTAATGG + Intergenic
1114784129 14:25574853-25574875 CCATCTCATTTCAGCCCTGAAGG - Intergenic
1115078161 14:29416249-29416271 CAACCATGTTGGAACCCTGAGGG + Intergenic
1130515922 15:84625725-84625747 CCACCTAGCTTAAGCCCTGAGGG + Intronic
1132788480 16:1671428-1671450 CCATCTGGTTGTAGCCCTCAAGG + Intronic
1137795046 16:51210012-51210034 ACACCTCTTTGGTGTCCTGAAGG - Intergenic
1139848583 16:69937172-69937194 CCACCTCGTTGAAGCCATCCAGG - Exonic
1140474515 16:75232859-75232881 CCACCTCCTTGGTGCCCAGAAGG + Intronic
1140516777 16:75548929-75548951 CCAACTTGTTGGAGTCCTGAAGG + Intronic
1143621201 17:8081053-8081075 CCACCTCCCTGGACCCCTGCCGG + Exonic
1144305499 17:13966175-13966197 CTGCCTATTTGGAGCCCTGATGG + Intergenic
1144645787 17:16972485-16972507 ACACCTCAATGGAGCCTTGAAGG - Intergenic
1148793363 17:50185837-50185859 CGATCTCGTTGGAGCCCTGGAGG + Exonic
1151557340 17:74853122-74853144 CACCCTGGTTGAAGCCCTGAGGG + Intronic
1161722995 19:5914050-5914072 CCTCCTCCTTGGAGCCAGGAAGG + Intronic
1161810185 19:6466977-6466999 CCGTCTCCTTGGAGTCCTGAGGG - Exonic
1163533878 19:17866115-17866137 CCACGTGGTTGAAGCCCTGGAGG - Intergenic
1163646905 19:18494772-18494794 CCACCTGGTCAGAGCCCAGAAGG - Intronic
1163790462 19:19303150-19303172 CCAGGTCCTTGGAGCACTGAGGG + Intronic
1168349624 19:55668630-55668652 CCACCTCATCCCAGCCCTGATGG + Intronic
925453335 2:3990605-3990627 CCACAGGGTTGGAGCCCTCATGG - Intergenic
932162731 2:69476931-69476953 CCACCTTGTCCGAGCCCTCAGGG + Exonic
934717635 2:96552710-96552732 CCACCTCCTTGGCCCCCTAATGG - Intergenic
938405397 2:131030103-131030125 CCACCTCTCCGGAGTCCTGAGGG - Intronic
948122989 2:235544600-235544622 CCACCTTGGTGGACCACTGATGG - Intronic
948839532 2:240642263-240642285 CGACCTCGCTGGAGCCCGCACGG + Intergenic
1171484936 20:25479645-25479667 CCACCTAGCTGGTACCCTGACGG + Intronic
1172977922 20:38920313-38920335 CTACCTCCTTAGAGCTCTGAAGG + Exonic
1173433637 20:43013405-43013427 CCACCTCTTTTGTGCCCAGAGGG + Intronic
1175218034 20:57401664-57401686 CCGCCTGGGTGGACCCCTGAGGG + Intronic
1176522381 21:7834106-7834128 CAACCTGTTTGGAGCCCTGCAGG + Intergenic
1178404885 21:32315921-32315943 CCACCTCCCTGGAGCTCTAACGG + Intronic
1178656401 21:34464118-34464140 CAACCTGTTTGGAGCCCTGCAGG + Intergenic
1182755244 22:32673897-32673919 TCATCTCCTGGGAGCCCTGATGG + Intronic
952694221 3:36247119-36247141 ACATCTGGTTGGAGCCCAGAAGG - Intergenic
954782747 3:53073108-53073130 CCACCGCGAAGGAGGCCTGACGG + Intronic
960429304 3:117549158-117549180 TTACCTCCTTGGAGCCCTTATGG + Intergenic
968629353 4:1642132-1642154 CCACCTCGTCGGTGTCCTCAGGG + Intronic
969344461 4:6562579-6562601 CCACCTCACTGGGCCCCTGAAGG + Intronic
972131666 4:35843547-35843569 TCAACTGGTTGGAGCTCTGAAGG - Intergenic
982067125 4:151664189-151664211 GCATCTCTGTGGAGCCCTGAGGG + Intergenic
987078551 5:14405916-14405938 CCACCTGAAGGGAGCCCTGAAGG + Exonic
990159735 5:52924331-52924353 CCATTTCAGTGGAGCCCTGAAGG + Intronic
990482995 5:56229697-56229719 CCACCTCGTTGGAGCCCTGAAGG + Intronic
996078838 5:119231686-119231708 CCACCTCGGTGAAGCCTTAATGG - Intronic
998629759 5:143884937-143884959 CTACCTCCTTGGAACCCTCAGGG + Intergenic
1002878839 6:1234579-1234601 CCACCTCCTTGAAGGTCTGATGG + Intergenic
1003966362 6:11256127-11256149 GCAACTCTCTGGAGCCCTGAGGG + Intronic
1010462084 6:76125086-76125108 CCAACTCAGTGGAGCCCTGTTGG + Intergenic
1015819150 6:137241814-137241836 CCAGCTCGTTGGATCCCACAAGG + Intergenic
1020255017 7:6498039-6498061 GAGCCTCGCTGGAGCCCTGAGGG - Intronic
1024177023 7:46851014-46851036 ACTCCTGCTTGGAGCCCTGAAGG - Intergenic
1024306388 7:47932744-47932766 TCACCTCATTGGAGCCATGTGGG - Intronic
1026074820 7:67156684-67156706 CCACATCTCTGGAGCCCTGCTGG - Intronic
1026702040 7:72655478-72655500 CCACATCCCTGGAGCCCTGCTGG + Intronic
1035079115 7:156201674-156201696 CCCCCTCGTTAGAGTCCGGAGGG + Intergenic
1039423818 8:37468729-37468751 ACACCTTGTTGGAGTCCTTAAGG - Intergenic
1039844593 8:41316801-41316823 CTCCCTCCTGGGAGCCCTGAAGG - Intergenic
1045357778 8:101404756-101404778 CCACCTGGGTGGAGCTCTGGAGG - Intergenic
1047400156 8:124539322-124539344 CCACCTCCATGGGGCCCCGAGGG - Intronic
1049404807 8:142447594-142447616 CTTCCTCCTTGGAGCCCGGAGGG - Intergenic
1050165882 9:2764206-2764228 CCACCTACTTGGAAGCCTGAGGG + Intronic
1053732728 9:41074259-41074281 CCACCATGGTGCAGCCCTGACGG + Intergenic
1054695699 9:68357295-68357317 CCACCATGGTGCAGCCCTGACGG - Exonic
1057259917 9:93577401-93577423 CCACCTCGCCGGAGCCCCCACGG - Intronic
1060060974 9:120459226-120459248 CCACCTTCTTGGATCACTGAGGG + Intronic
1062234526 9:135501464-135501486 CCACCTTGCTGGACTCCTGATGG + Intronic
1062520660 9:136956458-136956480 CCATCTCGTTGGGGCCGTCAGGG - Intronic
1062731752 9:138113880-138113902 CCACCTTGTGGGAGACGTGAGGG + Intronic
1185565192 X:1089687-1089709 GCATCTCGTTGGTGCCCTGTTGG + Intergenic
1186283306 X:8017795-8017817 CCAGCTTGTTGGAGGCCTGCTGG + Intergenic
1186886870 X:13922538-13922560 CGACCTGGTTGGAGGCTTGAAGG - Intronic
1188434478 X:30145237-30145259 ACTCCTCTCTGGAGCCCTGAGGG - Intergenic
1189210951 X:39281699-39281721 CCACTTTGTTGAAGGCCTGATGG - Intergenic
1192450584 X:71242215-71242237 CCACCTTGGTGGTGCCCCGAGGG + Exonic
1195599970 X:106734987-106735009 CCACCACCTTGGAGCCCTATGGG + Intronic
1200118903 X:153781294-153781316 CCTCGTCGTCGGAGCCCAGAAGG - Exonic