ID: 990484740

View in Genome Browser
Species Human (GRCh38)
Location 5:56247047-56247069
Sequence GACATTGTGGTGACTAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990484738_990484740 -10 Left 990484738 5:56247034-56247056 CCTTGGTGCTAGGGACATTGTGG No data
Right 990484740 5:56247047-56247069 GACATTGTGGTGACTAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990484740 Original CRISPR GACATTGTGGTGACTAGAAC AGG Intergenic
No off target data available for this crispr