ID: 990487753

View in Genome Browser
Species Human (GRCh38)
Location 5:56276063-56276085
Sequence GAGACCTATGTCAATACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990487753_990487765 14 Left 990487753 5:56276063-56276085 CCCCCAGTATTGACATAGGTCTC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 990487765 5:56276100-56276122 CCACCTTCATCATTGTGACCAGG 0: 1
1: 5
2: 4
3: 62
4: 715
990487753_990487766 15 Left 990487753 5:56276063-56276085 CCCCCAGTATTGACATAGGTCTC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 990487766 5:56276101-56276123 CACCTTCATCATTGTGACCAGGG 0: 1
1: 5
2: 7
3: 12
4: 205
990487753_990487767 16 Left 990487753 5:56276063-56276085 CCCCCAGTATTGACATAGGTCTC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 990487767 5:56276102-56276124 ACCTTCATCATTGTGACCAGGGG 0: 1
1: 6
2: 2
3: 15
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990487753 Original CRISPR GAGACCTATGTCAATACTGG GGG (reversed) Intergenic
906390267 1:45409162-45409184 GAGAGCTCATTCAATACTGGAGG + Intronic
906811770 1:48834361-48834383 GAGAACGATGTGAATATTGGGGG + Intronic
914473360 1:148003026-148003048 GAGACATATGTCCATAATGAAGG - Intergenic
916931264 1:169580178-169580200 GAGACCTATCTCCAGTCTGGTGG - Intronic
920099622 1:203508717-203508739 GAGACCTTTGTCCATGCTGCCGG - Exonic
924056550 1:240129800-240129822 AAGAGCAATGTCAATAATGGTGG - Intronic
1063310734 10:4949541-4949563 GACACCTATGTCAATATGGTTGG + Intronic
1072386459 10:94935208-94935230 GAGAACTAAGTCATTGCTGGTGG + Intergenic
1073167122 10:101465390-101465412 GAGAGCTATTTAAATATTGGAGG + Intronic
1091671315 12:2454077-2454099 GACACAAATGTCAAAACTGGAGG - Intronic
1093295434 12:17384092-17384114 GAGACCTATGCCAATACTGGAGG - Intergenic
1093396844 12:18693321-18693343 GAGACCTATGCAGATACTGGGGG + Intronic
1093725730 12:22506167-22506189 AAGACCTATGTAAACACTGTGGG - Intronic
1093884611 12:24445059-24445081 GAGACTAATGTCAGTCCTGGAGG - Intergenic
1100488829 12:95058347-95058369 GAAACCGCTGTCAATACTGCAGG - Exonic
1100755466 12:97746568-97746590 CAGCCTAATGTCAATACTGGAGG - Intergenic
1109460598 13:62652225-62652247 GAGAGCTATTTCAATAATGTAGG - Intergenic
1109581787 13:64348769-64348791 GAGACTTTTGTCACTCCTGGAGG - Intergenic
1112866955 13:103914855-103914877 AAGACCTAAGTCAATAATGGTGG + Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1120977717 14:90264119-90264141 GAGACCTATGCAGATATTGGGGG + Exonic
1122336095 14:100985732-100985754 GAGACCTATGTAAGTAATAGTGG + Intergenic
1123015201 14:105370279-105370301 GGGGCCCATGTCAATAGTGGGGG - Intronic
1130909704 15:88262588-88262610 GAGGGCTATGTCTATAATGGAGG - Intergenic
1137691884 16:50434085-50434107 GTGATCTATGGCAAGACTGGAGG + Intergenic
1143149971 17:4801687-4801709 GAGACCTATGCCAAGCATGGTGG - Intergenic
1146475327 17:33157991-33158013 GAAAGCCATGTCAATGCTGGGGG - Intronic
1147854537 17:43469048-43469070 GAGTCTTATGGCAATCCTGGAGG - Intergenic
1148125110 17:45232415-45232437 AAGAGCTATGTGGATACTGGTGG + Exonic
1151009114 17:70472993-70473015 GTGACATATGTGAATACTGGTGG - Intergenic
1154198320 18:12281956-12281978 GAGATCTATGTCAGGAATGGGGG - Intergenic
1154217854 18:12428700-12428722 GAGAGCTTTGTCCATGCTGGAGG + Intronic
1161201508 19:3017737-3017759 GAGACCTAGGTCGATCATGGTGG - Intronic
926548065 2:14266851-14266873 GAGACCTTTGGCATTACTTGAGG + Intergenic
926868405 2:17385633-17385655 GAGACCTATGCCAATATTGGGGG + Intergenic
927515710 2:23670517-23670539 GAGGCCTATGTCAGGCCTGGGGG - Intronic
929871923 2:45766328-45766350 CAGACCTCTGTCAATTCTGAAGG + Intronic
945179746 2:207079697-207079719 GAGGCCTCTGTTAATCCTGGGGG + Exonic
947320921 2:228917620-228917642 GCAACCTATCTGAATACTGGAGG + Intronic
1170802864 20:19604605-19604627 GAGATCTAGGTTAACACTGGGGG - Intronic
1172945178 20:38681803-38681825 GAGAACTTTGTCACTGCTGGTGG + Intergenic
1176217676 20:63955997-63956019 GAGACCAAGGTCAACGCTGGGGG + Intronic
1176894217 21:14357069-14357091 GGGGCCTGTGTGAATACTGGAGG - Intergenic
956378011 3:68636248-68636270 GAGACCTATGCAGATATTGGGGG + Intergenic
957823558 3:85410902-85410924 GTGACCTATGTGAGGACTGGTGG + Intronic
957991317 3:87631056-87631078 GAGACCTATGCCAGTATTGGTGG - Intergenic
963709020 3:148725126-148725148 GAGACTTATATGAATACTAGGGG + Intronic
964579935 3:158222465-158222487 GTGAAATATGTAAATACTGGGGG - Intronic
964619747 3:158709648-158709670 CAAACCCATGTCAACACTGGAGG - Intronic
964872597 3:161329690-161329712 GAGACCTATGCTGATACTGGGGG - Intergenic
966051315 3:175620142-175620164 GAATCCTATGTCATTTCTGGGGG - Intronic
972912019 4:43829103-43829125 GAGACCTGTCTCAATTTTGGAGG + Intergenic
973533496 4:51856918-51856940 GAGATCTATTCCAATGCTGGAGG - Intronic
973735670 4:53869332-53869354 GAGACCTCTGTCAACACCAGTGG - Intronic
982399846 4:154954341-154954363 AAGTCCTATGTCATTTCTGGGGG - Intergenic
984085934 4:175311345-175311367 GGGATCTATTTCAATCCTGGAGG + Intergenic
988770004 5:34422845-34422867 GAGACCTGTCTCAAATCTGGGGG + Intergenic
990487753 5:56276063-56276085 GAGACCTATGTCAATACTGGGGG - Intergenic
997215412 5:132105744-132105766 AAGAGCCATGTCAATACTGGTGG - Intergenic
1011868540 6:91862345-91862367 GAGACATATGGCTTTACTGGGGG + Intergenic
1014029530 6:116684365-116684387 GAGACAAATCTCACTACTGGTGG - Intronic
1015342550 6:132118326-132118348 CAGACAGATGTCAATACTGCAGG - Intergenic
1022137435 7:27462232-27462254 GAGACCTGTGTTGATACTGGGGG + Intergenic
1022627958 7:32057537-32057559 GGAACCTATTTAAATACTGGAGG - Intronic
1036510500 8:9395529-9395551 AAGACCTATGCCAATTTTGGGGG + Intergenic
1036633989 8:10535638-10535660 AAGGCCTATGTCAAGAATGGTGG - Intronic
1036738450 8:11340313-11340335 GAGGCCCATCTCAAAACTGGCGG - Intergenic
1040393773 8:46975296-46975318 GAGACCTAAGCCGACACTGGGGG - Intergenic
1041038859 8:53825462-53825484 AAAACCTAGGTAAATACTGGGGG + Intronic
1044255333 8:90053547-90053569 GAGAAATATGGCTATACTGGTGG - Intergenic
1044488230 8:92778871-92778893 GAGATCAATGTCTATGCTGGTGG - Intergenic
1056905807 9:90646689-90646711 GAGACCTAGGCCAGTCCTGGAGG - Intergenic
1058907910 9:109496737-109496759 GGGACATCTGACAATACTGGAGG + Intronic
1059526232 9:114993213-114993235 AAGACCTATGTCAATGACGGAGG + Intergenic
1192342762 X:70277679-70277701 GGGACCCATGTCAAGGCTGGAGG - Intronic
1194442483 X:93950064-93950086 GAGACCTGTCTCAATTTTGGAGG - Intergenic
1199588733 X:149444987-149445009 GTGAAATATTTCAATACTGGAGG + Intergenic
1201505949 Y:14700273-14700295 GAGACCTATTTCACTGCAGGTGG - Intronic