ID: 990488074

View in Genome Browser
Species Human (GRCh38)
Location 5:56278612-56278634
Sequence CGTGCATTCCAGGGTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990488068_990488074 29 Left 990488068 5:56278560-56278582 CCAGGGAATTCTTTGAAAGGCAA No data
Right 990488074 5:56278612-56278634 CGTGCATTCCAGGGTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990488074 Original CRISPR CGTGCATTCCAGGGTCTTGG AGG Intergenic
No off target data available for this crispr