ID: 990488449

View in Genome Browser
Species Human (GRCh38)
Location 5:56281136-56281158
Sequence GGGCCCACTGGAGCAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990488449_990488452 -7 Left 990488449 5:56281136-56281158 CCAGCTCCTGCTCCAGTGGGCCC No data
Right 990488452 5:56281152-56281174 TGGGCCCAAAAAATTCCTCCAGG No data
990488449_990488456 1 Left 990488449 5:56281136-56281158 CCAGCTCCTGCTCCAGTGGGCCC No data
Right 990488456 5:56281160-56281182 AAAAATTCCTCCAGGCAAGTGGG No data
990488449_990488455 0 Left 990488449 5:56281136-56281158 CCAGCTCCTGCTCCAGTGGGCCC No data
Right 990488455 5:56281159-56281181 AAAAAATTCCTCCAGGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990488449 Original CRISPR GGGCCCACTGGAGCAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr