ID: 990490693

View in Genome Browser
Species Human (GRCh38)
Location 5:56300186-56300208
Sequence ATGTGCGAGTATGGGTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990490687_990490693 3 Left 990490687 5:56300160-56300182 CCTCTTTGAGCAAGACCCTCATC No data
Right 990490693 5:56300186-56300208 ATGTGCGAGTATGGGTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990490693 Original CRISPR ATGTGCGAGTATGGGTGTGA GGG Intergenic
No off target data available for this crispr