ID: 990491601

View in Genome Browser
Species Human (GRCh38)
Location 5:56308395-56308417
Sequence AAGCATATCAAAAGGCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990491601_990491606 21 Left 990491601 5:56308395-56308417 CCATCTTGCCTTTTGATATGCTT No data
Right 990491606 5:56308439-56308461 TTAAGTTACAGCTTTTTTGCTGG No data
990491601_990491605 -3 Left 990491601 5:56308395-56308417 CCATCTTGCCTTTTGATATGCTT No data
Right 990491605 5:56308415-56308437 CTTTTTGATTGGGATAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990491601 Original CRISPR AAGCATATCAAAAGGCAAGA TGG (reversed) Intergenic
No off target data available for this crispr