ID: 990494438

View in Genome Browser
Species Human (GRCh38)
Location 5:56333466-56333488
Sequence AACACACTCATGACTGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990494438_990494443 29 Left 990494438 5:56333466-56333488 CCACTCCCAGTCATGAGTGTGTT No data
Right 990494443 5:56333518-56333540 CCTTTCCATTTCCCACATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990494438 Original CRISPR AACACACTCATGACTGGGAG TGG (reversed) Intergenic
No off target data available for this crispr