ID: 990497533

View in Genome Browser
Species Human (GRCh38)
Location 5:56363487-56363509
Sequence TTGTGTGTGTGCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990497533_990497541 13 Left 990497533 5:56363487-56363509 CCCTCCTCCCTGCACACACACAA No data
Right 990497541 5:56363523-56363545 CCCAAGTGTCAACAGCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990497533 Original CRISPR TTGTGTGTGTGCAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr