ID: 990497664

View in Genome Browser
Species Human (GRCh38)
Location 5:56364887-56364909
Sequence AGTTGCCTTAAGGCAGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990497664_990497671 16 Left 990497664 5:56364887-56364909 CCCATTCCTGCCTTAAGGCAACT No data
Right 990497671 5:56364926-56364948 TTGTGTATAGGTATATATGAGGG No data
990497664_990497669 4 Left 990497664 5:56364887-56364909 CCCATTCCTGCCTTAAGGCAACT No data
Right 990497669 5:56364914-56364936 AGAAGTGGATGCTTGTGTATAGG No data
990497664_990497670 15 Left 990497664 5:56364887-56364909 CCCATTCCTGCCTTAAGGCAACT No data
Right 990497670 5:56364925-56364947 CTTGTGTATAGGTATATATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990497664 Original CRISPR AGTTGCCTTAAGGCAGGAAT GGG (reversed) Intergenic
No off target data available for this crispr