ID: 990504426

View in Genome Browser
Species Human (GRCh38)
Location 5:56430551-56430573
Sequence CCCTCCAGGGAAACAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990504417_990504426 10 Left 990504417 5:56430518-56430540 CCCCATCCTGCTATTCATAACTC No data
Right 990504426 5:56430551-56430573 CCCTCCAGGGAAACAATGGAAGG No data
990504419_990504426 8 Left 990504419 5:56430520-56430542 CCATCCTGCTATTCATAACTCTT No data
Right 990504426 5:56430551-56430573 CCCTCCAGGGAAACAATGGAAGG No data
990504420_990504426 4 Left 990504420 5:56430524-56430546 CCTGCTATTCATAACTCTTCCGA No data
Right 990504426 5:56430551-56430573 CCCTCCAGGGAAACAATGGAAGG No data
990504418_990504426 9 Left 990504418 5:56430519-56430541 CCCATCCTGCTATTCATAACTCT No data
Right 990504426 5:56430551-56430573 CCCTCCAGGGAAACAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990504426 Original CRISPR CCCTCCAGGGAAACAATGGA AGG Intergenic
No off target data available for this crispr