ID: 990510194

View in Genome Browser
Species Human (GRCh38)
Location 5:56482421-56482443
Sequence CACCCACATCTCACAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990510184_990510194 19 Left 990510184 5:56482379-56482401 CCCCTAGCCTGGTACTGGGATTC No data
Right 990510194 5:56482421-56482443 CACCCACATCTCACAGGGGCTGG No data
990510188_990510194 -6 Left 990510188 5:56482404-56482426 CCAAACACCCATGAGATCACCCA No data
Right 990510194 5:56482421-56482443 CACCCACATCTCACAGGGGCTGG No data
990510186_990510194 17 Left 990510186 5:56482381-56482403 CCTAGCCTGGTACTGGGATTCTT No data
Right 990510194 5:56482421-56482443 CACCCACATCTCACAGGGGCTGG No data
990510185_990510194 18 Left 990510185 5:56482380-56482402 CCCTAGCCTGGTACTGGGATTCT No data
Right 990510194 5:56482421-56482443 CACCCACATCTCACAGGGGCTGG No data
990510187_990510194 12 Left 990510187 5:56482386-56482408 CCTGGTACTGGGATTCTTCCAAA No data
Right 990510194 5:56482421-56482443 CACCCACATCTCACAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990510194 Original CRISPR CACCCACATCTCACAGGGGC TGG Intergenic
No off target data available for this crispr