ID: 990510629

View in Genome Browser
Species Human (GRCh38)
Location 5:56486400-56486422
Sequence CCTCATCTGTAAAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990510629_990510639 19 Left 990510629 5:56486400-56486422 CCCTCCCCATTTTACAGATGAGG 0: 15
1: 99
2: 349
3: 811
4: 1556
Right 990510639 5:56486442-56486464 AAAGAGACAGTTACCTTCCTAGG No data
990510629_990510636 -5 Left 990510629 5:56486400-56486422 CCCTCCCCATTTTACAGATGAGG 0: 15
1: 99
2: 349
3: 811
4: 1556
Right 990510636 5:56486418-56486440 TGAGGGAATTCAGTCCCAAATGG No data
990510629_990510640 23 Left 990510629 5:56486400-56486422 CCCTCCCCATTTTACAGATGAGG 0: 15
1: 99
2: 349
3: 811
4: 1556
Right 990510640 5:56486446-56486468 AGACAGTTACCTTCCTAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990510629 Original CRISPR CCTCATCTGTAAAATGGGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr