ID: 990510780

View in Genome Browser
Species Human (GRCh38)
Location 5:56487547-56487569
Sequence CAATAGGACTAGTGGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990510774_990510780 -1 Left 990510774 5:56487525-56487547 CCATTTTTCTTAGATTTAGTCCC No data
Right 990510780 5:56487547-56487569 CAATAGGACTAGTGGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990510780 Original CRISPR CAATAGGACTAGTGGGAAGT TGG Intergenic
No off target data available for this crispr