ID: 990513257

View in Genome Browser
Species Human (GRCh38)
Location 5:56508700-56508722
Sequence CCTGAAATCCTGCTTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990513257_990513266 3 Left 990513257 5:56508700-56508722 CCTGCTCCAAGCAGGATTTCAGG No data
Right 990513266 5:56508726-56508748 AGGGCATGGCGCTGGGCGAAAGG No data
990513257_990513264 -5 Left 990513257 5:56508700-56508722 CCTGCTCCAAGCAGGATTTCAGG No data
Right 990513264 5:56508718-56508740 TCAGGGCAAGGGCATGGCGCTGG No data
990513257_990513265 -4 Left 990513257 5:56508700-56508722 CCTGCTCCAAGCAGGATTTCAGG No data
Right 990513265 5:56508719-56508741 CAGGGCAAGGGCATGGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990513257 Original CRISPR CCTGAAATCCTGCTTGGAGC AGG (reversed) Intergenic
No off target data available for this crispr