ID: 990514218

View in Genome Browser
Species Human (GRCh38)
Location 5:56517078-56517100
Sequence CTGACTGTGCAGAGCAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990514214_990514218 26 Left 990514214 5:56517029-56517051 CCACTGAATGGCCTTCAGAGCAG 0: 1
1: 0
2: 1
3: 18
4: 185
Right 990514218 5:56517078-56517100 CTGACTGTGCAGAGCAACTTTGG No data
990514216_990514218 15 Left 990514216 5:56517040-56517062 CCTTCAGAGCAGAACTGAGGCTT 0: 1
1: 3
2: 29
3: 66
4: 342
Right 990514218 5:56517078-56517100 CTGACTGTGCAGAGCAACTTTGG No data
990514217_990514218 -8 Left 990514217 5:56517063-56517085 CCTGATGAAGAAATTCTGACTGT 0: 1
1: 1
2: 5
3: 31
4: 234
Right 990514218 5:56517078-56517100 CTGACTGTGCAGAGCAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990514218 Original CRISPR CTGACTGTGCAGAGCAACTT TGG Intronic
No off target data available for this crispr