ID: 990516317

View in Genome Browser
Species Human (GRCh38)
Location 5:56534190-56534212
Sequence TAGCCTAGGGCTTTGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 313}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990516317 Original CRISPR TAGCCTAGGGCTTTGGGAAG GGG (reversed) Intronic
900597930 1:3490904-3490926 TAGCCCAGGGCTCAGGTAAGGGG - Exonic
900714224 1:4133634-4133656 TACCCAAGGGCATTGGCAAGAGG - Intergenic
900795770 1:4707421-4707443 TTGCCCAAGGCTTGGGGAAGGGG - Intronic
900827352 1:4937431-4937453 TAGCATTGGGCTTTGGAAGGAGG - Intergenic
901657620 1:10779309-10779331 TGGCCTAGGGTTTTGGGCAAAGG + Intronic
901778244 1:11575414-11575436 AAGGCAAGGGCTGTGGGAAGGGG - Intergenic
902520870 1:17015341-17015363 AATCCTAGCGCTTTGGGAGGTGG - Intergenic
902817869 1:18926400-18926422 TGGCCCAGGGCTGTGGGAAGTGG - Intronic
903334946 1:22618569-22618591 CAGCCAAGGGCCTTGGGCAGGGG + Intergenic
903772448 1:25772451-25772473 TAGCCTGAGCCATTGGGAAGAGG + Intronic
904184611 1:28693702-28693724 AATCCTAGCACTTTGGGAAGCGG - Intronic
904407220 1:30300193-30300215 CAGCTGAGGGCTTTAGGAAGGGG + Intergenic
904989511 1:34580377-34580399 TAGGCTGGGGGTGTGGGAAGTGG - Intergenic
906166959 1:43693766-43693788 TAACCTAGGGCAGTGGGCAGTGG + Intronic
907166321 1:52414672-52414694 AAGGATAGGGCTTTGGGGAGGGG + Intronic
907660052 1:56383650-56383672 GAGCTTAGGGTTTTGGGGAGAGG - Intergenic
907812200 1:57882376-57882398 TAGTCTAGGACTCTGAGAAGGGG - Intronic
907851639 1:58260432-58260454 TAGCCTATGGCTGGGAGAAGAGG - Intronic
908193648 1:61728130-61728152 TAGCCTAGGGCTGGGCGCAGTGG + Intergenic
911925865 1:103831934-103831956 AATCCTAGCACTTTGGGAAGTGG + Intergenic
913597779 1:120394818-120394840 TGGGCTAGGGGTTAGGGAAGGGG - Intergenic
914089554 1:144484496-144484518 TGGGCTAGGGGTTAGGGAAGGGG + Intergenic
914309057 1:146449716-146449738 TGGGCTAGGGGTTAGGGAAGGGG - Intergenic
914402122 1:147331580-147331602 TCTCCTTGTGCTTTGGGAAGGGG + Intergenic
914593054 1:149123411-149123433 TGGGCTAGGGGTTAGGGAAGGGG + Intergenic
914682644 1:149950032-149950054 TAGCCTAAGGCTTTGCAAAAGGG + Intronic
915270458 1:154749923-154749945 TAGCCCAGGCCTATGGAAAGAGG - Intronic
915316159 1:155030230-155030252 TAAAATAGGGCTCTGGGAAGGGG + Exonic
915324750 1:155075640-155075662 GAGGCTAGGGCCTGGGGAAGGGG - Intergenic
916051852 1:161041987-161042009 GAGCCTAGTGCTTTGGGACAAGG + Intronic
921604952 1:217140788-217140810 TAGCCTAGACCTCTGGGAAAGGG - Intergenic
923008791 1:230072225-230072247 TTTCTTAGGGCTTTGGGGAGAGG + Intronic
923872312 1:238008957-238008979 TGTCCTTGGGCTTTGAGAAGAGG + Intergenic
924400502 1:243675452-243675474 AATCCTAGCACTTTGGGAAGTGG - Intronic
924693947 1:246380866-246380888 TAGGCTATGGCCATGGGAAGAGG + Intronic
1063151413 10:3339900-3339922 TAGCCAAGGGCTCTGGGCGGAGG + Intergenic
1063656339 10:7993962-7993984 GAGCATAGGGTTTTGGAAAGGGG + Intronic
1064597931 10:16964865-16964887 AAGCCTAGGGCTTAGGGGAGAGG - Intronic
1065136856 10:22679854-22679876 TTGCCTAGGGCTGGGGGTAGGGG + Intronic
1065481153 10:26195095-26195117 TCGCCTAGAGCTTGGGGCAGGGG - Intronic
1068162114 10:53278225-53278247 TTGCCTGGGGCTGTAGGAAGGGG - Intergenic
1069468496 10:68664084-68664106 TATCCTAGCACTTTGGGAGGTGG - Intronic
1069474801 10:68722669-68722691 TATCCTAGCACTTTGGGAAGCGG + Intronic
1069515419 10:69073180-69073202 TAGCCTAAGGGTTTGGGCAGAGG - Intergenic
1069754800 10:70767338-70767360 AATCCTAGCGCTTTGGGAGGTGG + Intergenic
1071438397 10:85667947-85667969 TTGCCTAGGGCTTAGGGATGGGG - Intronic
1071728367 10:88222293-88222315 CAGCCTAGTGCTGTGGGATGAGG - Intergenic
1072678098 10:97483831-97483853 CAGCCCATGGCTTTGGGATGAGG - Intronic
1073139006 10:101235694-101235716 TAGCCCAGGGGTCTGTGAAGAGG + Intergenic
1073205632 10:101767947-101767969 TTGCCTGCAGCTTTGGGAAGAGG - Intergenic
1075500645 10:122970757-122970779 TACCCTAGGGCTTTATGAAATGG + Intronic
1075785400 10:125046014-125046036 TAGCCTTGGGGTGTGGGAAGTGG - Intronic
1075846402 10:125548508-125548530 CAGCCCAGGGCTCTGGGAACAGG - Intergenic
1076590638 10:131579917-131579939 CAGCCTAGGCCTTGGGGACGGGG + Intergenic
1076756736 10:132576464-132576486 TAGCCTTGGGCTCTGGGCTGTGG + Intronic
1077639555 11:3869220-3869242 AAACCTAGCACTTTGGGAAGTGG - Intronic
1077682469 11:4255642-4255664 TTGCCTGGGGCTAGGGGAAGAGG - Intergenic
1077687564 11:4311097-4311119 TTGCCTGGGGCTAGGGGAAGAGG + Intergenic
1077692732 11:4362285-4362307 TTGCCTGGGGCTAGGGGAAGAGG + Intergenic
1077697859 11:4411546-4411568 TAGCCTGGCTCTTTGGAAAGAGG + Intergenic
1077722584 11:4643382-4643404 AGCCCTAGGGCTTTGGGAAAAGG + Intergenic
1078684559 11:13516452-13516474 TTGCCTAGGGCTTAAGGAAGAGG - Intergenic
1080605069 11:33858844-33858866 AAGCTTAAGGCCTTGGGAAGGGG + Exonic
1081736610 11:45408853-45408875 AAGCCCAGGGCTTTGGGACCTGG - Intergenic
1082026014 11:47572915-47572937 TGGCCTAAGGCTGTGGGGAGGGG - Exonic
1082063991 11:47883930-47883952 TAGCCAGGGGCTGGGGGAAGTGG + Intergenic
1083115961 11:60459990-60460012 TATCCTAGCACTTTGGGAGGTGG + Intronic
1084529181 11:69717084-69717106 CTGGCTGGGGCTTTGGGAAGAGG - Intergenic
1084856669 11:71993373-71993395 TAAACCAGGGCTGTGGGAAGGGG - Intronic
1084899606 11:72299798-72299820 TAGGCTGGGGCTGGGGGAAGGGG + Intronic
1085138127 11:74113272-74113294 TTGCTTAGGGCTGGGGGAAGAGG + Intronic
1086778629 11:90873893-90873915 TTGCCTAGGGCTGGGGGAAAGGG + Intergenic
1087050219 11:93879286-93879308 TTGCCTAGGGCTGAGGGCAGAGG - Intergenic
1087923046 11:103889051-103889073 TGGCGTAGGTCTTTGAGAAGAGG - Intergenic
1088040166 11:105371709-105371731 TTTCCTTGGACTTTGGGAAGAGG + Intergenic
1088684825 11:112275842-112275864 TAGCCTAGGTTTATGGGAGGAGG - Intergenic
1090722822 11:129492390-129492412 TATCTTAGGGCTTTGGAAAATGG - Intergenic
1091221447 11:133931954-133931976 TTGCCCAGGGCTTTTGGAAGGGG + Intronic
1092358544 12:7816958-7816980 AATCCTAGGACTTTGGGAGGTGG - Intronic
1092570613 12:9717155-9717177 AATCCTAGCGCTTTGGGAGGCGG + Intronic
1092812360 12:12283746-12283768 AATCCTAGTGCTTTGGGAGGTGG + Intergenic
1095460640 12:42440830-42440852 TAGCTTAGCAATTTGGGAAGTGG - Intronic
1095719494 12:45385467-45385489 GAACCTTGGGCTTTGGTAAGTGG + Intronic
1096279161 12:50236822-50236844 AATCCCAGCGCTTTGGGAAGTGG + Intronic
1096522925 12:52194237-52194259 TAGCCTGGGGCTCTGGGCTGGGG + Intergenic
1097259461 12:57708376-57708398 AATCCTAGCACTTTGGGAAGTGG + Intronic
1097461708 12:59871402-59871424 ATGTCTAGGGCTTTGGGAATTGG - Intergenic
1098590487 12:72205516-72205538 TTGCCAAGGGCTGGGGGAAGAGG - Intronic
1099742386 12:86656455-86656477 AAGCATAGGGGTTTGAGAAGTGG - Intronic
1100602046 12:96120451-96120473 TAGCCTAGGGCTTGGGGTTGAGG + Intergenic
1100627043 12:96346068-96346090 AATCCCAGGACTTTGGGAAGTGG + Intronic
1100819977 12:98421553-98421575 TAGCCCTGCGCTTTTGGAAGTGG - Intergenic
1101577234 12:106008866-106008888 CAACCTTGGGCTGTGGGAAGGGG - Intergenic
1102235619 12:111292721-111292743 TTGCCTAGGGCTGCAGGAAGGGG + Intronic
1103042771 12:117709569-117709591 TATCCTAGCACTTTGGGAGGTGG - Intronic
1103812179 12:123623922-123623944 AATCCTAGCACTTTGGGAAGTGG + Intronic
1104224014 12:126813415-126813437 AGGCCCAGGGCTTTGGGCAGGGG + Intergenic
1104393166 12:128408427-128408449 GAGCCAAGGGCTCTGTGAAGGGG - Intronic
1104401827 12:128482752-128482774 GAAGCTGGGGCTTTGGGAAGAGG - Intronic
1104884754 12:132100264-132100286 CTGACTAGGGCTGTGGGAAGGGG + Intronic
1105620968 13:22065575-22065597 TATCCCAGGGCTTTGAGAAAGGG - Intergenic
1106019640 13:25902321-25902343 TTTCCCAAGGCTTTGGGAAGGGG - Intronic
1106342623 13:28845201-28845223 TACCCCAGTGCTTTGGGAGGCGG - Intronic
1107092730 13:36499778-36499800 TGCCCTAGAGTTTTGGGAAGAGG - Intergenic
1108326924 13:49342681-49342703 TAAACTAGGACTTAGGGAAGGGG - Intronic
1108331075 13:49384930-49384952 GAGCCTAGGGTTTTTGGAATGGG + Intronic
1110494033 13:76144915-76144937 TAGCCTATTGATTTGAGAAGTGG + Intergenic
1111164289 13:84437984-84438006 CAGCCTAGAGGTTTGGGGAGAGG + Intergenic
1112313206 13:98338318-98338340 TTGCCAGGGGCTTTGGGGAGGGG - Intronic
1113374832 13:109755513-109755535 GAGGGAAGGGCTTTGGGAAGGGG - Exonic
1116457925 14:45140785-45140807 AATCCTAGTGCTTTGGGAGGTGG + Intronic
1116468266 14:45257481-45257503 TTGCCTAGGACTGTGGGGAGGGG - Intergenic
1117922772 14:60742658-60742680 TTGCCTAGTGCTATGGGAGGGGG - Intronic
1118824461 14:69367721-69367743 AATCCTAGCGCTTTGGGAAGTGG + Intergenic
1119584947 14:75824555-75824577 TTGCCAAGGGCTGGGGGAAGAGG + Intronic
1124898400 15:33798961-33798983 TGTCCTAGGGCTTAGGGAACTGG + Intronic
1125445960 15:39756588-39756610 AATCCCAGCGCTTTGGGAAGTGG - Intronic
1126164441 15:45642601-45642623 CAGTCTAGCGCTCTGGGAAGAGG - Intronic
1126574788 15:50185982-50186004 AATCCTAGCACTTTGGGAAGTGG + Intronic
1127135021 15:55911024-55911046 TAGCCTGGGGATGTGGGAGGCGG - Intronic
1127358355 15:58223429-58223451 TACCCCAAGACTTTGGGAAGTGG + Intronic
1129321034 15:74775145-74775167 CAGCCTTGGGATGTGGGAAGAGG + Intergenic
1130306925 15:82718643-82718665 AATCCCAGGACTTTGGGAAGTGG + Intergenic
1131370538 15:91877632-91877654 TAGGGAAGGCCTTTGGGAAGGGG + Intronic
1131637266 15:94249421-94249443 CTGCCTTGGGCTTTGGAAAGGGG - Intronic
1132087550 15:98920865-98920887 GAGCAGAGGGCTTTGGGAAAGGG - Intronic
1132502104 16:289006-289028 CAGCCTAGGGCTTGGAGAAGTGG + Intronic
1132597435 16:759735-759757 TACCCAAGGGCTCTGGGGAGGGG - Intronic
1132829683 16:1921365-1921387 TTGCCAGGGGCTGTGGGAAGGGG - Intergenic
1134315785 16:13117673-13117695 TTCCCTAGAGCCTTGGGAAGGGG + Intronic
1136399124 16:30008311-30008333 AAGCCAAGGGCTCTGAGAAGGGG + Intronic
1137341175 16:47607344-47607366 TTGCCTAGTGCTGGGGGAAGAGG - Intronic
1137719882 16:50621758-50621780 CAGCTTGGGGCTTTGGGAGGAGG + Intronic
1138757645 16:59507951-59507973 CAGCCTAGGGTTTTGCCAAGGGG + Intergenic
1138876663 16:60959667-60959689 AATCCTAGTACTTTGGGAAGCGG - Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139496241 16:67320727-67320749 TAGCCTCTGGCTTTCTGAAGAGG + Exonic
1139582814 16:67883396-67883418 TACCCTAGGGGATTGGGAAATGG - Intronic
1139702191 16:68714761-68714783 AATCCCAGCGCTTTGGGAAGCGG + Intronic
1140737498 16:77911437-77911459 AAGCCCAGGGCCTTGGGCAGGGG - Intronic
1142497145 17:312048-312070 AATCCCAGTGCTTTGGGAAGCGG + Intronic
1142735286 17:1894418-1894440 CATCCCAGCGCTTTGGGAAGCGG - Intronic
1142770539 17:2093628-2093650 TAGCCTAGGGCCAAGGGGAGAGG + Intronic
1143155191 17:4832180-4832202 TGGGCTAGGGGTTAGGGAAGGGG + Intergenic
1143913712 17:10273377-10273399 AATCCTAGCACTTTGGGAAGTGG - Intergenic
1146113187 17:30110593-30110615 TTGCCTAGGGCTGGGGGTAGGGG - Intergenic
1146256471 17:31393755-31393777 TGGCCTAGGGCTTCAGGAACTGG - Intronic
1146725154 17:35150234-35150256 CAGCCAAGGGTTGTGGGAAGAGG - Intronic
1146826237 17:36025424-36025446 TATCCTAGCACTTTGGGAGGTGG - Intergenic
1146909596 17:36640074-36640096 TTGCCTAGGGCTAGGGGACGGGG - Intergenic
1147443024 17:40458905-40458927 AAGCCTAGAGCATCGGGAAGGGG - Intergenic
1147979735 17:44267144-44267166 TAGCATAGTGCTTAGGGATGTGG - Intronic
1148287713 17:46410478-46410500 AATCCTAGTGCTTTGGGAGGTGG + Intergenic
1148309882 17:46628058-46628080 AATCCTAGTGCTTTGGGAGGTGG + Intronic
1148380076 17:47189811-47189833 TATCCTATGTCTTTGGGGAGTGG - Intergenic
1149666921 17:58371406-58371428 TAGCCTGGGGCTTGGGGAGCAGG - Intronic
1149974074 17:61248503-61248525 GAGCCTTGGGCCTTGGGAGGAGG + Intronic
1150230516 17:63547276-63547298 AATCCCAGGGCTTTGGGAGGAGG + Intronic
1150236707 17:63599153-63599175 TTGCCTAGGGCTGTGGGAATTGG + Intergenic
1150738773 17:67762623-67762645 AATCCCAGTGCTTTGGGAAGTGG - Intergenic
1150825060 17:68466925-68466947 TTGCCAAGGGCTTGGGGAGGAGG - Intergenic
1151307120 17:73270186-73270208 AATCCTAGGACTTTGGGAGGTGG + Intergenic
1151458572 17:74241404-74241426 GAGCCGGGGGCTTTGGGGAGTGG - Intronic
1151717499 17:75838658-75838680 AAGGCTATGGCATTGGGAAGCGG + Intronic
1151740642 17:75979513-75979535 TTGGCTGGGGCCTTGGGAAGGGG + Intronic
1151753481 17:76056064-76056086 AATCCTAGTGCTTTGAGAAGCGG - Intronic
1151767138 17:76138445-76138467 GAGCCGAGGGCTTTGGCCAGAGG - Intronic
1153444690 18:5157945-5157967 AATCCCAGTGCTTTGGGAAGTGG - Intronic
1158138151 18:54228282-54228304 AATCCTAGGGCTTCGGGAAGTGG - Intergenic
1158167089 18:54553207-54553229 TAGCCTAGGGTTTAGTGTAGTGG + Intergenic
1160358649 18:78250867-78250889 TAGGAGAGGACTTTGGGAAGTGG + Intergenic
1160693103 19:469163-469185 TTGCCCAGGGCCTGGGGAAGGGG - Intronic
1162304349 19:9862719-9862741 AATCCTAGCACTTTGGGAAGTGG + Intronic
1162926882 19:13935257-13935279 TAGCCTTGGGGAGTGGGAAGAGG - Intronic
1164510350 19:28891371-28891393 TTGTCAAGGGCTTTGGGAAATGG - Intergenic
1165012224 19:32857189-32857211 AATTCCAGGGCTTTGGGAAGTGG + Intronic
1168289937 19:55352703-55352725 AACCCTAGGGCTTTGTCAAGCGG + Exonic
926439975 2:12877926-12877948 TTGCCTAGGGGTGTGGGGAGGGG + Intergenic
926619320 2:15032980-15033002 TAGCTCATGGCTTTGGGCAGAGG - Intergenic
927326986 2:21816276-21816298 AAGCCTAGCACTTTGGGAGGTGG - Intergenic
927642358 2:24853270-24853292 CATCCTTGGGCTTTGGGAAGGGG - Intronic
928601454 2:32907729-32907751 TTGCCAAGGGCTGTGGGGAGCGG - Intergenic
929902465 2:46017219-46017241 TTGCCAAGGGCTGTGGGGAGAGG - Intronic
930737833 2:54797660-54797682 CAGCTAAGGTCTTTGGGAAGTGG + Intronic
930962409 2:57277133-57277155 TGCCCTGGGGCTTTGTGAAGGGG + Intergenic
931047225 2:58368657-58368679 TTACCTAGGGCTTGGGGAGGGGG + Intergenic
931412769 2:62049391-62049413 TATCCTGGGGGTTTGGGAGGAGG + Intronic
932092549 2:68819175-68819197 TATCCTTGGACTTGGGGAAGAGG - Exonic
932447641 2:71790684-71790706 CAGCCAAGGGCTCTGGGCAGGGG - Intergenic
933175028 2:79165234-79165256 TTGCTTAGGGTTTTGGGATGAGG + Intergenic
934042484 2:88139595-88139617 AACCCTAGTGTTTTGGGAAGGGG + Intergenic
935178547 2:100670482-100670504 CTGCCCAGGGCTTAGGGAAGAGG + Intergenic
936273564 2:111071052-111071074 TAGCCAAGTGCTCTGGGGAGAGG - Intronic
936935242 2:117833564-117833586 CAGACTTGGGCTTTGGAAAGCGG + Intergenic
936976930 2:118229885-118229907 TAGCCTAGGGGTTGGAGCAGTGG + Intergenic
937004687 2:118500850-118500872 AAGAATAGGGCTTTGGGGAGTGG + Intergenic
938238124 2:129722808-129722830 GAGCCCAGGGCGTTGGGAACTGG - Intergenic
938723299 2:134085188-134085210 TTGCCTAGGGCTGGGGGAATGGG + Intergenic
938781967 2:134592656-134592678 TAGCCCAGGGGGTTGGGGAGGGG + Intronic
939183043 2:138826175-138826197 AATCCTAGCACTTTGGGAAGTGG - Intergenic
941807698 2:169725393-169725415 AATCCCAGTGCTTTGGGAAGTGG - Intronic
941987100 2:171520733-171520755 AATCCCAGGGCTTTGGGAGGTGG - Intergenic
943372543 2:187032639-187032661 AATCCCAGGGCTTTGGGAGGCGG - Intergenic
944340177 2:198586797-198586819 TTGCCTTGGGCTAGGGGAAGGGG + Intergenic
946955876 2:224929490-224929512 TAGGCTATGGCTTTGAGAAATGG + Intronic
947503582 2:230689975-230689997 TAGCCTTGTGCTTTGGGTTGTGG + Intergenic
948626372 2:239271296-239271318 TAGAGTAGGGGTTTGAGAAGGGG + Intronic
1169638039 20:7716753-7716775 TTGCCTGGGGCTGGGGGAAGGGG + Intergenic
1173368657 20:42414083-42414105 AATCCTAGCACTTTGGGAAGCGG - Intronic
1175225495 20:57441724-57441746 TGGCCAAGCGGTTTGGGAAGCGG + Intergenic
1175303966 20:57963341-57963363 TTGCCAAGGGCTTGGGGGAGGGG + Intergenic
1175568336 20:59998641-59998663 TATCTTAGGGCTCTGAGAAGTGG + Intronic
1176088885 20:63310246-63310268 GAGCCCAGGCCTGTGGGAAGTGG + Intronic
1176175450 20:63721096-63721118 AATGCTAGGACTTTGGGAAGTGG + Intronic
1177120544 21:17132522-17132544 AAACCTAGGGGTTTGGGAATTGG - Intergenic
1178586704 21:33876645-33876667 AATCCCAGTGCTTTGGGAAGTGG + Intronic
1179070758 21:38068636-38068658 TAGTCGAGGTCTGTGGGAAGAGG + Intronic
1180109284 21:45640541-45640563 TACCCCAGTGCTTTGTGAAGAGG + Intergenic
1180208885 21:46281566-46281588 TATCCTAGCACTTTGGGAGGTGG + Intronic
1181235202 22:21444338-21444360 CAGCCCAGGGCCTTGGGGAGAGG + Intronic
1181998439 22:26901625-26901647 AATCCTAGGACTTTGGGAGGCGG + Intergenic
1182267364 22:29128063-29128085 TTGCCAAGGGCTGGGGGAAGGGG + Intronic
1182346231 22:29667492-29667514 AATCCTAGCACTTTGGGAAGGGG - Intronic
1184337828 22:43864879-43864901 TAACCTGGGGCATTGGAAAGAGG + Intergenic
1184466872 22:44673683-44673705 TAGTCTAGGGCTTGGGTAGGTGG + Intronic
1184864564 22:47195129-47195151 GAGCTTAGGGCTCTGGGAAAAGG + Intergenic
1185384787 22:50526702-50526724 CAGCCTAGGGCTTCGGGTCGCGG - Exonic
950939595 3:16879808-16879830 TAGACTAAGGGATTGGGAAGGGG + Intronic
952169858 3:30794992-30795014 GACCCTAGGGCCTAGGGAAGTGG + Intronic
956122729 3:65982197-65982219 TCTCCTGTGGCTTTGGGAAGAGG + Intronic
956919978 3:73917895-73917917 TAGCCTAGGGCTTTGGGGTTGGG + Intergenic
962574238 3:136741209-136741231 TTGCATAGGTCATTGGGAAGAGG - Intronic
964343312 3:155731016-155731038 GAGCCTAGGGCTGTGGGATCTGG - Intronic
965209112 3:165761882-165761904 TATCTTAGGCCTTTGGGAACCGG - Intergenic
965607164 3:170509019-170509041 TAACCAAGGGCATCGGGAAGAGG - Intronic
967526481 3:190500734-190500756 TTGCCAAGGGCTTGGGGAAGGGG - Intergenic
968547865 4:1207845-1207867 TGGTCAAGGGCTTGGGGAAGCGG + Intronic
968619406 4:1597117-1597139 GAGCCCAGGCCTGTGGGAAGAGG - Intergenic
968749134 4:2377891-2377913 TAGCCTAGGTCTGTCGGAGGCGG - Intronic
969524869 4:7699298-7699320 TAGCTTGGGGCTCTGGGAAAAGG - Intronic
970794454 4:19894040-19894062 TAGCCTTGTGCCTTGGGAATGGG - Intergenic
971792716 4:31189107-31189129 TAGATTAGGGCTGTGGGCAGTGG - Intergenic
972027088 4:34395143-34395165 TTGCCAAGGGTTTTTGGAAGAGG + Intergenic
973532441 4:51846156-51846178 GAGCCTAGGGCTTTGGGGAATGG - Intronic
975327507 4:73076780-73076802 TAGCAGAGGGCTGTGGGCAGTGG - Intronic
976850815 4:89542436-89542458 GGGCCTAGAGCTGTGGGAAGTGG - Intergenic
977112004 4:92968751-92968773 TTGCCTAGGGCTAGGGGACGTGG - Intronic
977381997 4:96287308-96287330 TAGCCTAGAGCATGGGGAACTGG + Intergenic
978194584 4:105956291-105956313 TAGCATTGGGGTTGGGGAAGAGG - Intronic
979779805 4:124636578-124636600 CAGCCTAGGGATCTGTGAAGAGG - Intergenic
980227404 4:130004516-130004538 AATCCTAGTGCTTTGGGAGGCGG + Intergenic
982321359 4:154080674-154080696 AATCCCAGCGCTTTGGGAAGTGG - Intergenic
983732941 4:171020527-171020549 TATCCTAGGGCTTTTGCAAGTGG - Intergenic
983865283 4:172759174-172759196 TAGGCTAGGGGCTTGGTAAGTGG - Intronic
985620484 5:952384-952406 TTGCCTGGGACCTTGGGAAGAGG - Intergenic
990516317 5:56534190-56534212 TAGCCTAGGGCTTTGGGAAGGGG - Intronic
992326624 5:75666269-75666291 CAGGCTGGGGCTTGGGGAAGAGG - Intronic
994107226 5:95961379-95961401 TAGCCTGGGCGTTGGGGAAGCGG - Intronic
994381010 5:99071188-99071210 TAGCAAAGGGCATTGGGAAGTGG + Intergenic
996433845 5:123412331-123412353 TGGACTAGAGCTTTAGGAAGCGG - Intronic
998050296 5:139026724-139026746 TTTCTTAGGGCTTAGGGAAGGGG + Intronic
998308789 5:141105193-141105215 AATCCTAGCACTTTGGGAAGTGG - Intronic
998880025 5:146636239-146636261 TATCCTTGGGCGTTAGGAAGAGG + Intronic
1001118015 5:168955704-168955726 TAGCCTGGGCCTTTTGGCAGTGG - Intronic
1001162718 5:169335750-169335772 AAGCCCAGGGCATTGGGGAGAGG + Intergenic
1004026284 6:11822568-11822590 TAGCCTTGGGCTTTGGGATGTGG - Intergenic
1004043265 6:12003472-12003494 TAGCCTAGGGATTTAGGATGTGG + Intergenic
1004554726 6:16684434-16684456 TAGCCAAGGGTTTGGGTAAGGGG - Intronic
1004825496 6:19415763-19415785 TTGCCTAGGGCTAGGGGCAGTGG - Intergenic
1005358978 6:25012709-25012731 TTGCCTATGGCTGGGGGAAGGGG + Intronic
1005524538 6:26632926-26632948 TAACCCAGTACTTTGGGAAGTGG - Intergenic
1005699089 6:28382043-28382065 TAGCAAAAGGCTTTGGGAATAGG - Exonic
1007971443 6:46055913-46055935 TTGGCTGGGGCTATGGGAAGAGG + Intronic
1009040528 6:58170973-58170995 TACCCTTTGGCTTTTGGAAGGGG - Intergenic
1009216384 6:60925503-60925525 TACCCTTTGGCTTTTGGAAGGGG - Intergenic
1009694428 6:67082593-67082615 TGGCCTATTGCTTTGGGCAGAGG + Intergenic
1009790670 6:68398029-68398051 TTGCCAAGGGCTAAGGGAAGGGG + Intergenic
1012323506 6:97883585-97883607 TAGACTAAGGCCTTGGGAATTGG - Intergenic
1014325096 6:119984293-119984315 TATCCTAGCACTTTGGGAGGTGG - Intergenic
1017383259 6:153855206-153855228 TTGCTTAGAGCTTGGGGAAGTGG + Intergenic
1017428879 6:154350971-154350993 AATCCTAGCACTTTGGGAAGCGG - Intronic
1019751348 7:2732296-2732318 AATCCTGGTGCTTTGGGAAGTGG + Intronic
1020063060 7:5167072-5167094 AAGCCCAGGACTTTGGGAGGTGG + Intergenic
1025019539 7:55469930-55469952 AATCCCACGGCTTTGGGAAGTGG + Intronic
1026411481 7:70127388-70127410 AATCCCAGGGCTTTGGGAGGGGG - Intronic
1026657876 7:72273057-72273079 TAGCCCATGGCTCTGGGCAGAGG - Intronic
1026866508 7:73827542-73827564 GATCTTCGGGCTTTGGGAAGAGG + Intronic
1026941676 7:74290695-74290717 TGGCCTAGGGCTGTGGGCAGAGG + Intronic
1028370573 7:90087278-90087300 TACCCTGGGGCTTTGGGACCAGG - Intergenic
1029540067 7:101177603-101177625 TATCCCAGCACTTTGGGAAGTGG - Intronic
1031404393 7:121367183-121367205 TTGCCTAGAGATGTGGGAAGGGG - Intronic
1031752453 7:125593709-125593731 CTGCCTAGGACTTTGGGAGGTGG - Intergenic
1033132241 7:138754505-138754527 TAGCCTAAGGGTTTTGAAAGAGG + Intronic
1033235011 7:139631111-139631133 TGGCCCAGCGCTTAGGGAAGAGG - Intronic
1033243650 7:139701426-139701448 TAGGTGAGGGCTTTGGGAACAGG - Intronic
1034416949 7:150970305-150970327 TGGCCTTGGGCTCTGGGGAGGGG - Intronic
1034494961 7:151414767-151414789 TTGCCTAGGGCTTGGGGAAGAGG + Intergenic
1036086022 8:5614176-5614198 TAGCTTGGGGCTCAGGGAAGTGG + Intergenic
1039225455 8:35383823-35383845 AATCCCAGGGCTTTGGGAGGAGG + Intronic
1040922441 8:52637414-52637436 GAGCCTAGGGGTTTGTGAACAGG - Intronic
1041673162 8:60513081-60513103 TACTCTCAGGCTTTGGGAAGAGG - Intergenic
1041791199 8:61698053-61698075 AATCCTAGCACTTTGGGAAGTGG - Intronic
1042392407 8:68251039-68251061 TTGCCAGGGGCTGTGGGAAGGGG + Intergenic
1043481417 8:80656521-80656543 TAGCCTAAGGCTGTGGGGAGAGG - Intronic
1043560517 8:81488272-81488294 TTCCTTAGGGCTGTGGGAAGGGG + Intergenic
1044460037 8:92433587-92433609 TAGCCTAGAGATAAGGGAAGGGG - Intergenic
1045602482 8:103733369-103733391 TTGCCTGGGGCTGGGGGAAGGGG + Intronic
1045688239 8:104733908-104733930 TGGCCTAGGGGTTGGGTAAGGGG + Intronic
1045988180 8:108274894-108274916 AATCCTAGCACTTTGGGAAGCGG + Intronic
1047603755 8:126453541-126453563 AATCCTAGCGCTTTGGGAGGCGG + Intergenic
1047705645 8:127496880-127496902 TAAGGTATGGCTTTGGGAAGAGG + Intergenic
1049007056 8:139862425-139862447 CAGCCTTGGGCCTTGGGGAGAGG + Intronic
1051634968 9:19173249-19173271 TAGCCTAGGACCTGGGGCAGGGG + Intergenic
1052370969 9:27664130-27664152 TACTCTAGTGCATTGGGAAGAGG - Intergenic
1052856597 9:33410833-33410855 TGGGCTAGGCCCTTGGGAAGGGG - Intergenic
1053166255 9:35846164-35846186 TAGGCTAGGGTTCCGGGAAGTGG + Intronic
1054527759 9:66151965-66151987 AATCCTAGCGCTTTGGGAGGCGG + Intronic
1055618302 9:78095996-78096018 GATCCTAGTGCTTTGGGAGGCGG + Intergenic
1057728766 9:97590477-97590499 TATCCTAGCACTTTGGGAGGCGG - Intronic
1058758562 9:108106422-108106444 TAGCCTGGTGATTTGGGAAGGGG - Intergenic
1058999466 9:110333410-110333432 TGGACTAGGGCTTAGGGTAGGGG - Intronic
1059041404 9:110819175-110819197 TAGGCAAGGGCTTTGGCAAGGGG - Intergenic
1061173662 9:128978115-128978137 TAACCCAGTGCTTTGGGAGGCGG + Intronic
1062001960 9:134220667-134220689 CCACCGAGGGCTTTGGGAAGAGG + Intergenic
1062048489 9:134435358-134435380 AAGTCTGGGGCTCTGGGAAGAGG - Intronic
1185862493 X:3592270-3592292 TTGCATAGGGCTTAGGGAATTGG + Intergenic
1190239966 X:48650190-48650212 AATCCTAGCACTTTGGGAAGCGG - Intergenic
1190414650 X:50168929-50168951 TTACTTAGGGCTTGGGGAAGGGG + Intergenic
1191197568 X:57741133-57741155 AAGCTTAGGGCTTTGGGAGATGG + Intergenic
1195546834 X:106122736-106122758 TGGCCTAGGGTTTTGTGGAGTGG + Intergenic
1195651327 X:107288071-107288093 TAGCCAAGGGCTGTGGGGAGGGG - Intergenic
1195900649 X:109794089-109794111 TTGCCCAGGGCTGGGGGAAGGGG + Intergenic
1196082534 X:111648972-111648994 TAGCCTAGGGCCATGGGGACTGG + Intergenic
1196271477 X:113716672-113716694 TCTCCTAGGGGTTTGGGCAGTGG + Intergenic
1196401916 X:115325660-115325682 TTGCCTTGGGCTGTGAGAAGGGG - Intergenic
1197331621 X:125159944-125159966 AATCCTAGCGCTTTGGGAGGTGG + Intergenic
1199748280 X:150790188-150790210 TAGACTAGGGTTGAGGGAAGGGG + Intronic
1200130247 X:153838783-153838805 TATCCCAGCACTTTGGGAAGTGG - Intergenic
1200421407 Y:2973299-2973321 AATCCCAGGGCTTTGGGAGGTGG - Intronic
1201061755 Y:10052368-10052390 TAGCCTGGGGAGTTGGGGAGAGG + Intergenic
1201374368 Y:13300415-13300437 TAGCCGGGGGCTTGGGGCAGGGG + Intronic