ID: 990517072

View in Genome Browser
Species Human (GRCh38)
Location 5:56540234-56540256
Sequence CAGGGTAATAAACATTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990517068_990517072 26 Left 990517068 5:56540185-56540207 CCATCAGAAAGAAGTGTGAATTG 0: 1
1: 0
2: 0
3: 24
4: 236
Right 990517072 5:56540234-56540256 CAGGGTAATAAACATTTTTCAGG 0: 1
1: 0
2: 3
3: 17
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990517072 Original CRISPR CAGGGTAATAAACATTTTTC AGG Intronic
901931513 1:12598913-12598935 AAAGGAAATAAACATTTTACTGG + Intronic
903537040 1:24073906-24073928 CAGTGAAATTTACATTTTTCTGG - Intronic
904231679 1:29079295-29079317 CAAAGTAAAAATCATTTTTCTGG - Intronic
904621529 1:31778244-31778266 CAGGTTCATAAATATTTTTCTGG - Intergenic
908025907 1:59951334-59951356 CAGGGAAAGTGACATTTTTCTGG - Intergenic
908971166 1:69833366-69833388 CAGAGTAGTAAACATGATTCAGG + Intronic
909700805 1:78520508-78520530 CAGTGTAATAAAGAAATTTCCGG + Intronic
909770962 1:79420644-79420666 CAGGAAAATAAATATTTTTGTGG + Intergenic
909796435 1:79743291-79743313 TAAGGTAATAAATATTTTTGAGG + Intergenic
909845187 1:80384815-80384837 CAGGGAAATAAACATTCTTCTGG - Intergenic
909851774 1:80475097-80475119 CAGGAAAATAAAGATTTTTTTGG + Intergenic
910432106 1:87168935-87168957 CAGGGTGTTAAACATTTTTCAGG - Exonic
910987040 1:93015225-93015247 CAGAGTAAAAACCATGTTTCCGG - Intergenic
911052567 1:93682909-93682931 CAAGGTAATGAAGATTTTTTTGG - Intronic
911456187 1:98126638-98126660 CATGCCAATAAGCATTTTTCTGG - Intergenic
911791542 1:102021985-102022007 AAAGCTAAAAAACATTTTTCAGG - Intergenic
912068170 1:105773539-105773561 CAGGTAAAGAAACATATTTCTGG - Intergenic
913666127 1:121050460-121050482 TGTGGTAATAACCATTTTTCTGG + Intergenic
914017528 1:143833736-143833758 TGTGGTAATAACCATTTTTCTGG + Intergenic
914656139 1:149742268-149742290 TGTGGTAATAACCATTTTTCTGG + Intergenic
917580053 1:176367632-176367654 CTGGTTGTTAAACATTTTTCAGG + Intergenic
918811067 1:189121425-189121447 CATGGCACTAAACATTTTACTGG - Intergenic
922142125 1:222898176-222898198 CAGGGATATAAACATTGTTTGGG + Intronic
922439844 1:225645785-225645807 GTGGGTTATAAACATTTTTTGGG - Intronic
1063862584 10:10327745-10327767 CTGGGTAATAAACAGGTTTCTGG - Intergenic
1064399219 10:15007015-15007037 CAGCATAATAAACATTTGTATGG + Intergenic
1065439463 10:25735991-25736013 CAGGGTACTAATTATTTTTGTGG - Intergenic
1065450460 10:25851193-25851215 CAGTGAAATAAACATTTATCAGG + Intergenic
1065673978 10:28154702-28154724 CAGGGCATTAAACATTTCTTTGG + Intronic
1066797903 10:39145003-39145025 CAGAGTATTAAACCTTTCTCTGG + Intergenic
1068107397 10:52635871-52635893 CAGGGTATGAAATATTTTTATGG - Intergenic
1068326569 10:55496420-55496442 CAAGGAAATAAACATTTTAATGG - Intronic
1068326638 10:55497553-55497575 CAAGGAAATAAACATTTTAATGG - Intronic
1068401915 10:56538565-56538587 AAGGTTAATAAAAATTTTACTGG - Intergenic
1068806422 10:61199386-61199408 CAGGGTCATAAAGATCTTTAAGG - Intergenic
1069164918 10:65142886-65142908 CAGGCATATCAACATTTTTCAGG + Intergenic
1070179030 10:73997419-73997441 GAGATTAATAAACATTTTCCTGG - Intergenic
1071140903 10:82508317-82508339 CAGGCTAAAATACATTTATCTGG - Intronic
1072811251 10:98463816-98463838 AAAGGTAGAAAACATTTTTCAGG + Intronic
1073828773 10:107358056-107358078 CATGGCATTAAACATTTTTCAGG - Intergenic
1075483575 10:122801942-122801964 CACAGTTAAAAACATTTTTCAGG - Intergenic
1075608240 10:123831805-123831827 TAGGGTAGAAAAGATTTTTCTGG - Intronic
1076019283 10:127057212-127057234 CAAGGTAATAAACATGCTGCAGG - Intronic
1077604439 11:3598790-3598812 CAGCATAATAAACATTTGTATGG + Intergenic
1077986999 11:7362633-7362655 CAAGGTGAAAAACATTATTCAGG - Intronic
1078024026 11:7677767-7677789 CAGGATAAAAGGCATTTTTCTGG + Intergenic
1078039963 11:7851108-7851130 GAGGAAAATAAACATTTTTATGG - Intergenic
1079361069 11:19770717-19770739 CAGGGTAAAAAATAAGTTTCAGG - Intronic
1082304754 11:50558179-50558201 CATGGAAGTAAACATTTCTCTGG - Intergenic
1084226897 11:67721604-67721626 CAGCATAATAAACATTTGTATGG + Intergenic
1084812437 11:71621866-71621888 CAGCATAATAAACATTTGTATGG - Intergenic
1085328178 11:75624575-75624597 CAGGCTAATGAACATGCTTCAGG - Intronic
1085732023 11:79008054-79008076 CAGGGTGCTAAAAATTTTTATGG + Intronic
1087496925 11:98903206-98903228 CAAGGCAATAAATTTTTTTCTGG - Intergenic
1087584284 11:100098701-100098723 CAGGAGAATAACCATTTTGCTGG - Intronic
1088519422 11:110678964-110678986 TAGGGTAATAAATATTTGTTTGG - Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1090715999 11:129431670-129431692 CCGGGTAAAAATCATTTGTCAGG + Intronic
1091517951 12:1204584-1204606 CAGGGAACTGAACATATTTCAGG + Intronic
1092691996 12:11122743-11122765 CAGGGTAATAATAATTTTCATGG + Intronic
1093516483 12:19992557-19992579 CAGGATCATAAATTTTTTTCTGG - Intergenic
1094198472 12:27774519-27774541 CATCTTAATAAACATCTTTCTGG + Intergenic
1096599522 12:52719490-52719512 CAGGATTGTAAACATCTTTCTGG - Intergenic
1097681215 12:62650992-62651014 CAGGATAATAAACATCACTCTGG - Intronic
1098755376 12:74355726-74355748 AAGGGGGTTAAACATTTTTCTGG - Intergenic
1099695129 12:86009720-86009742 CATGGTAAGAAGCATATTTCTGG + Intronic
1102844755 12:116168308-116168330 GTGCTTAATAAACATTTTTCTGG + Intronic
1103420336 12:120775826-120775848 CAGGATAATAAATTATTTTCAGG - Intronic
1103868840 12:124076239-124076261 AAGGGGCATAAACATTTTTTAGG - Intronic
1105339162 13:19503770-19503792 CAGGGTCAAAAACATTTCTAGGG + Intronic
1107546529 13:41438665-41438687 CAGCCTAATAGACATTTTTATGG + Intergenic
1108907414 13:55495934-55495956 CAGAGTAATATACCTTTTTTTGG - Intergenic
1109394094 13:61732282-61732304 CAGGCTAATAATATTTTTTCTGG + Intergenic
1109509791 13:63354738-63354760 AAGGGAAATAAAGATTTTTCTGG + Intergenic
1109899772 13:68752086-68752108 AAATGTAATTAACATTTTTCAGG - Intergenic
1112041805 13:95554184-95554206 CTGGGGAATAAACACTGTTCCGG - Intronic
1113141263 13:107153204-107153226 CAGCAGAATACACATTTTTCAGG - Intergenic
1113232369 13:108226994-108227016 CAGGTTAATAAAAATTGCTCTGG - Intronic
1114489111 14:23085847-23085869 CAGGCTAATAAATACATTTCAGG + Intronic
1114725225 14:24929572-24929594 GAAGCTAATAAACATTTGTCTGG + Intronic
1115187644 14:30709163-30709185 CAGGTAAATAAACAATATTCAGG - Intronic
1115264661 14:31488533-31488555 AAGGTTAATAAACTTGTTTCGGG + Intergenic
1115659711 14:35480839-35480861 CATGGTAACAAACATTTGCCAGG - Intergenic
1115722596 14:36179362-36179384 CAATGTGATAAATATTTTTCAGG + Intergenic
1116178733 14:41508517-41508539 CTGGGTAATAAAAATATTTTCGG - Intergenic
1117034289 14:51711575-51711597 GAGGGGAATACAGATTTTTCAGG + Exonic
1117041216 14:51770942-51770964 CAGCATAATAAACATTTGTATGG + Intergenic
1117954659 14:61113112-61113134 GAGGTTAAGAAACATTTTTAAGG - Intergenic
1118217900 14:63826953-63826975 AAGGATACTAAACATTTATCAGG - Intergenic
1118908902 14:70045191-70045213 CAGGGTACTAAAGATCTTACAGG - Exonic
1119011875 14:71001306-71001328 AAGGGGAATATACATTTTTGGGG + Intronic
1120646249 14:87078058-87078080 CAGGATAATGTCCATTTTTCAGG + Intergenic
1121373139 14:93379385-93379407 CAGGCTAGTAAACTTTTTTGAGG + Intronic
1123140124 14:106068374-106068396 CTAGGAAATAAACATGTTTCAGG + Intergenic
1124889582 15:33720108-33720130 CAGTCTAATAAATTTTTTTCTGG + Intronic
1126432685 15:48603154-48603176 CAGGGTAAAAAATATATATCAGG - Intronic
1129151679 15:73692808-73692830 CAGGGAAATAACCAGTTTTATGG + Intronic
1133814431 16:9185635-9185657 CAGGTTCAGAAACATGTTTCAGG - Intergenic
1134877059 16:17709994-17710016 CTAGATAAAAAACATTTTTCTGG + Intergenic
1135184006 16:20299049-20299071 CAGGGAAATAAACACATTTTAGG + Intergenic
1135725822 16:24853288-24853310 CAGTGAAATAAACATTTATTAGG - Intronic
1137972325 16:52998348-52998370 CAGGGGGAAAAGCATTTTTCAGG - Intergenic
1138321241 16:56113909-56113931 CAGGGTAATCAAAAGTATTCTGG + Intergenic
1139313597 16:66048233-66048255 CAGTGTAATGCACATTTTTAAGG + Intergenic
1139716873 16:68820684-68820706 CATGGGTATTAACATTTTTCAGG - Intronic
1140159576 16:72474139-72474161 CAGACTGATAAACATTTTTGAGG - Intergenic
1143687244 17:8527581-8527603 CAAGGAAATAAACATTTATCGGG + Intronic
1143822194 17:9573691-9573713 CAAGGGTATAAACATTTTTAAGG - Intronic
1143996192 17:11008450-11008472 AAGGGTAGAAACCATTTTTCTGG + Intergenic
1144290761 17:13824041-13824063 CAAGGGAACACACATTTTTCCGG + Intergenic
1146200673 17:30855057-30855079 CTGGAAAATAAACATTTTTAGGG - Intronic
1148001429 17:44389708-44389730 CATGGTAATAAACTATTCTCAGG - Intergenic
1148405098 17:47405926-47405948 CTGGGTAATAAACATGTTTAAGG + Intronic
1148525601 17:48330089-48330111 CAGGCTAATAAATCTTTTGCAGG + Intronic
1149073954 17:52575921-52575943 TTGGGTAATAAACATCTTTTAGG - Intergenic
1150447052 17:65234403-65234425 CTGGGTATTAAACCTTTATCAGG - Intergenic
1153105976 18:1527390-1527412 CAGGCTTTTAAACATTTTTTAGG - Intergenic
1153382189 18:4453563-4453585 CAGGGTAAAAAATAATTTGCAGG + Intronic
1153513582 18:5882086-5882108 CAGTTTAATTAACATTTTTCAGG + Exonic
1157650074 18:49319275-49319297 CAGGCCTATTAACATTTTTCAGG - Intronic
1158367578 18:56755807-56755829 GAGGGTAATAAAGATTTATCTGG - Intronic
1164000615 19:21095040-21095062 CTGGGTATTAAACCTTTGTCAGG + Intronic
1165600828 19:37054763-37054785 CAGGTTGATAAACATTTTCTTGG + Intronic
926538621 2:14146333-14146355 CAGGGGAAAAAAAATTTATCTGG - Intergenic
928046682 2:27941191-27941213 CAGGGTAATAGATACCTTTCTGG - Intronic
928577444 2:32669508-32669530 CTGTTTAATAACCATTTTTCAGG + Intronic
929400518 2:41575375-41575397 CAGGGTGATAAACATTTTATGGG + Intergenic
930479524 2:51928367-51928389 AAAGGTAAGAAACATATTTCAGG - Intergenic
930589300 2:53308287-53308309 CAGGGTCAGAAAGATTTTTCAGG - Intergenic
930766851 2:55093478-55093500 CAGCATAATAAACACCTTTCTGG - Intronic
932025113 2:68124736-68124758 CTGATTAATAACCATTTTTCTGG + Intronic
932350881 2:71030721-71030743 CAGCATAATAAACATTTGTATGG - Intergenic
932407650 2:71524393-71524415 TAGGGGAATAGACATTTTTATGG + Intronic
933554050 2:83809861-83809883 AAGGGGAATAAACAGTGTTCTGG + Intergenic
934741608 2:96727692-96727714 CAGTGGTAAAAACATTTTTCTGG - Intronic
935515955 2:104039231-104039253 AAGTGTAATAAACATTTTGGAGG + Intergenic
937469114 2:122160049-122160071 CTGGCTAATAACCATTGTTCTGG - Intergenic
938186831 2:129239519-129239541 AAAGGGAATAAAGATTTTTCAGG + Intergenic
938922324 2:136006706-136006728 AAGGCTAATTAACATTTTTGGGG - Intergenic
939298319 2:140299372-140299394 CAAAGTAATATACATTTTTATGG + Intronic
940296020 2:152125235-152125257 GAGGGTAGGAAAGATTTTTCTGG - Intronic
940588968 2:155696333-155696355 AAGGTTAGTAAACATTTTTAGGG - Intergenic
942541225 2:177017442-177017464 GAGGGTAATATACACTCTTCTGG - Intergenic
944597466 2:201274390-201274412 CAGGGCAATTAACATGCTTCTGG - Intronic
944754719 2:202749166-202749188 AAGGATAGTAAAGATTTTTCAGG - Intronic
1175770596 20:61621451-61621473 CATGGTAATAAAGAATTTTTTGG + Intronic
1176735021 21:10538167-10538189 CAGGGTCAAAAACATTTCTAGGG - Intronic
1184529472 22:45045584-45045606 AAGGGCAATAAACATTCTCCAGG - Intergenic
949223758 3:1668910-1668932 CAGAGTAATAGACATATTTTGGG + Intergenic
949385619 3:3499027-3499049 CATGGTTATAAACATTTTTCTGG + Intergenic
949885487 3:8689986-8690008 CAGCATAATAAACATTTGTATGG - Intronic
950916498 3:16651211-16651233 CAGAAGAATAAACATTTGTCTGG - Intronic
951075908 3:18392084-18392106 CAGGGCACTAAATATTTTTTTGG + Intronic
951695164 3:25438744-25438766 TAGGGCATGAAACATTTTTCAGG - Intronic
951830073 3:26916705-26916727 AAGGACAATAAACATTTATCAGG + Intergenic
952127435 3:30317970-30317992 CAAGGTAAAAAACATTTATATGG - Intergenic
952661275 3:35851218-35851240 GAGAGTAATAAAGATTGTTCAGG - Intergenic
952916583 3:38250116-38250138 AAGGATAATAAAAATTTTCCTGG + Intronic
953135948 3:40182034-40182056 CAAGGGAATAAACATTTACCTGG + Intronic
957043500 3:75355646-75355668 CAGCATAATAAACATTTGTATGG + Intergenic
957075290 3:75597799-75597821 CAGCATAATAAACATTTGTATGG + Intergenic
957706237 3:83788957-83788979 CTGGGTACTAAAAAATTTTCTGG - Intergenic
958595242 3:96214434-96214456 CATGATAATAAACATTATGCTGG - Intergenic
958681701 3:97340181-97340203 AATGGTAAAAAATATTTTTCAGG + Intronic
959335637 3:105061322-105061344 AAGGCTGATAAACATTTTTCAGG + Intergenic
960129923 3:114045037-114045059 CAGGATAATATACAGATTTCAGG + Intronic
960217460 3:115059290-115059312 CAAAGTATTAGACATTTTTCTGG + Intronic
960409942 3:117310504-117310526 CAGATTAATGAACATTATTCTGG + Intergenic
960441381 3:117693161-117693183 CAGGGAAATAATCTTTTTTTTGG - Intergenic
960677964 3:120215397-120215419 CCAGATAGTAAACATTTTTCAGG - Intronic
961273157 3:125705180-125705202 CAGCATAATAAACATTTGTATGG - Intergenic
961275898 3:125726333-125726355 CAGCATAATAAACATTTGTATGG - Intergenic
961278811 3:125748929-125748951 CAGCATAATAAACATTTGTATGG - Intergenic
961875582 3:130020711-130020733 CAGCATAATAAACATTTGTATGG + Intergenic
962112106 3:132462611-132462633 TTGGGAAATAAACATTTCTCTGG + Intronic
965360189 3:167729625-167729647 CATGCTAATAAGCATTTTACAGG - Intronic
965696054 3:171409447-171409469 TAGAGTAATATTCATTTTTCAGG - Intronic
969018936 4:4125757-4125779 CAGCATAATAAACATTTGTATGG + Intergenic
969383734 4:6827756-6827778 CAGGGTTATAAACACATTTGTGG + Intronic
969730234 4:8951441-8951463 CAGCATAATAAACATTTGTATGG - Intergenic
969735107 4:8983245-8983267 CAGCATAATAAACATTTGTATGG - Intergenic
969789836 4:9485555-9485577 CAGCATAATAAACATTTGTATGG - Intergenic
969794318 4:9514725-9514747 CAGCATAATAAACATTTGTATGG - Intergenic
969839239 4:9868467-9868489 CAGGGTAGTAAACAATTCTGGGG - Intronic
970536814 4:17038418-17038440 GAGGGGAACAAACATCTTTCAGG + Intergenic
971544608 4:27869586-27869608 CCTGGAAAAAAACATTTTTCAGG - Intergenic
971750372 4:30639194-30639216 AAGGGTAATTTATATTTTTCAGG + Intergenic
972497096 4:39644243-39644265 CTGGGTAAAAAATATTTTGCAGG + Intergenic
972672330 4:41225578-41225600 TAGGTTAATGAACATTTTCCTGG - Intergenic
974411685 4:61549503-61549525 CAGTGTAATTATCATTTTTGTGG + Intronic
974671313 4:65033881-65033903 CTGGGTAATAAAAATTATTTGGG - Intergenic
976730755 4:88258755-88258777 CAAAGTTATAAGCATTTTTCTGG - Exonic
976768154 4:88620365-88620387 CAGGGTAAGAAACAGGTTTAAGG - Intronic
978788657 4:112637907-112637929 CAGGTTAAGAATCATTGTTCTGG - Intronic
983084932 4:163431558-163431580 CAGGGAAAAAAATATCTTTCAGG + Intergenic
983380365 4:166983744-166983766 AGGGGCAATATACATTTTTCAGG - Intronic
984680556 4:182604123-182604145 AAAGGAAATAAACATTTTTATGG - Intronic
984915250 4:184717847-184717869 CAGGTAAAAAAACCTTTTTCAGG + Intronic
986647160 5:9928737-9928759 CAGGATCCTAAAAATTTTTCTGG + Intergenic
987602599 5:20091092-20091114 AAAGGTCATAAATATTTTTCAGG - Intronic
987870715 5:23613894-23613916 CAGCGAAATAAAGCTTTTTCAGG + Intergenic
987877867 5:23703282-23703304 CAGCATAATAAATATTTTTGTGG + Intergenic
988493651 5:31726529-31726551 CTGGGTAATATACTTTTTTTTGG - Intronic
989383691 5:40834452-40834474 AAGTGTAAGTAACATTTTTCAGG - Exonic
990517072 5:56540234-56540256 CAGGGTAATAAACATTTTTCAGG + Intronic
990798153 5:59567613-59567635 CAGGGTAAAAAACATTTTGGGGG + Intronic
992648023 5:78830408-78830430 CAGGGTAAGCAACATTTTCTAGG - Intronic
994380683 5:99067530-99067552 GAGAGTAATAAACATCTATCAGG - Intergenic
994522987 5:100865045-100865067 CAGGGACATAACCATTGTTCGGG - Intronic
995003721 5:107165574-107165596 CAAGGTAATAAAAAATTTCCTGG + Intergenic
995997368 5:118318187-118318209 CACAGTAATAAACATATTTCAGG - Intergenic
996808467 5:127485755-127485777 AAGGGAAATAAACAGTGTTCAGG + Intergenic
999614159 5:153404633-153404655 CATGGAAATTAACATTTTTGTGG - Intergenic
1001235335 5:170024667-170024689 CAAGTTAATAAACATTTCTAAGG - Intronic
1003704429 6:8508567-8508589 CAATGTAACAAACACTTTTCTGG - Intergenic
1004531390 6:16458440-16458462 TTGGGTAATAAACATCTTTTAGG - Intronic
1005122454 6:22404637-22404659 CAGGATAAGACACAGTTTTCAGG - Intergenic
1006928034 6:37669599-37669621 CAGGGTCAGAAACATGGTTCTGG - Intronic
1007870340 6:45028837-45028859 AAGGCAAATAAACATTTTTATGG - Intronic
1008357665 6:50573720-50573742 CAAGGTAATAGACATGTCTCAGG + Intergenic
1008890475 6:56482991-56483013 CAGTTTAATAACCATATTTCTGG + Intronic
1009516390 6:64624283-64624305 CATGTTAATAAACATCTTACAGG - Intronic
1009563132 6:65274593-65274615 CAGGGTTATAAAAATTCTTCAGG + Intronic
1011574948 6:88787293-88787315 CAGGTTAACCAACATTTCTCAGG - Intronic
1012011799 6:93797355-93797377 CATACTAATAAACATTTTTGTGG - Intergenic
1013556365 6:111260457-111260479 CAGAGTAAAAGACATATTTCTGG - Intronic
1013633662 6:112008893-112008915 ATTGGTTATAAACATTTTTCTGG + Intergenic
1013637293 6:112041263-112041285 AATTGTAATAAACATTTTTGGGG + Intergenic
1013894110 6:115064339-115064361 AAGGGCAATATTCATTTTTCAGG + Intergenic
1014090067 6:117394305-117394327 CAGAGAAATAAACAATTTGCTGG + Exonic
1015664878 6:135617716-135617738 CAGGGAAAGAAACATTTGTTAGG - Intergenic
1017063134 6:150505216-150505238 CTGGTTAATAATCCTTTTTCAGG - Intergenic
1018260822 6:161969156-161969178 CACGGTAATGGACATTTTTGAGG - Intronic
1018963651 6:168466720-168466742 CATGGAAATAAACATGTTGCAGG - Intronic
1020570070 7:9849311-9849333 CAGTGAAATGATCATTTTTCTGG + Intergenic
1021835910 7:24674528-24674550 CAGGGTAATGAACATGCTGCTGG + Intronic
1023576338 7:41631726-41631748 CAGGCTGAAAAACATTCTTCTGG - Intergenic
1023797160 7:43803371-43803393 CAGGATAATAAAAAAGTTTCAGG - Intronic
1024677675 7:51651989-51652011 CTAGGTAAGAAACATTATTCTGG - Intergenic
1025592915 7:62885725-62885747 CACAGAAATAAACATTTCTCTGG + Intergenic
1027181325 7:75941585-75941607 CCAGGTAATAAATATTTTTTAGG + Intronic
1027884054 7:83880237-83880259 CAGGGTCATAAACCCTTTTGAGG + Intergenic
1029077390 7:97946131-97946153 CAGCATAATAAACATTTGTATGG + Intergenic
1030340723 7:108376809-108376831 CATGGTAGTAAACATTATTTTGG - Intronic
1030534953 7:110754801-110754823 TAGGGCAATAAACAGTTTTGTGG - Intronic
1033652526 7:143353659-143353681 CTGGGAAATATCCATTTTTCTGG - Exonic
1036261662 8:7245768-7245790 CAGCATAATAAACATTTGTATGG + Intergenic
1036313702 8:7704311-7704333 CAGCATAATAAACATTTGTATGG + Intergenic
1036905149 8:12702200-12702222 CAGCATAATAAACATTTGTATGG + Intergenic
1040129389 8:43776867-43776889 CAGAGAATTAAACATTTTTTTGG + Intergenic
1042219057 8:66455566-66455588 CAGGGGCATAAATATTTTTCAGG - Intronic
1042396646 8:68299203-68299225 CAGAAAAAAAAACATTTTTCTGG + Intergenic
1042716724 8:71781247-71781269 CAGGGAGATAAAGATTTTTAAGG + Intergenic
1043314291 8:78901095-78901117 CACCATAATAATCATTTTTCAGG + Intergenic
1043723789 8:83582715-83582737 AAGGGTAATGTTCATTTTTCAGG - Intergenic
1043788281 8:84430214-84430236 CATAGTGATAAAAATTTTTCAGG + Intronic
1043879863 8:85529934-85529956 AAGGGTTCTGAACATTTTTCTGG + Intergenic
1044802122 8:95968083-95968105 CAAGAAAATAAACAATTTTCAGG - Intergenic
1044945660 8:97386571-97386593 CAGGTTACTTAACCTTTTTCTGG - Intergenic
1046498176 8:115041247-115041269 AATGGAACTAAACATTTTTCTGG - Intergenic
1046531110 8:115446351-115446373 CAGGGGAAGAAACAGTTTTTGGG - Intronic
1046762811 8:118039105-118039127 CAGCATAATAAACATTTGTAAGG + Intronic
1046878461 8:119281493-119281515 CAGGTTACTAGAGATTTTTCAGG + Intergenic
1048561284 8:135540304-135540326 CACAGTAATGAACATGTTTCTGG - Intronic
1051112880 9:13660168-13660190 CACAGTAATATACATTTTTATGG + Intergenic
1053537081 9:38936873-38936895 CATGGAAATAACCATTTTTTAGG + Intergenic
1054629056 9:67427057-67427079 CATGGAAATAACCATTTTTTAGG - Intergenic
1055170292 9:73249210-73249232 CATGATAATAAATATTTTTAGGG + Intergenic
1056429532 9:86513639-86513661 CAGGGTAATAAACATCATTTGGG + Intergenic
1056866745 9:90233948-90233970 CAGCATAATAAACATTTGTATGG - Intergenic
1056916415 9:90750375-90750397 CAGCATAATAAACATTTGTATGG + Intergenic
1058212755 9:102191485-102191507 CATGCTATTAAACATTTTTGTGG - Intergenic
1058634124 9:107019858-107019880 CAGGGTAATAGATCTTTTGCTGG + Intergenic
1060380223 9:123162762-123162784 CAGAGTAATAATCCTTTTTGAGG - Intronic
1185758465 X:2671334-2671356 TGGAGTAATAAACATTATTCTGG - Intergenic
1192345412 X:70299745-70299767 CACTGTAATAGACATTTTGCTGG + Intronic
1192717946 X:73663658-73663680 CTTGGAAATAAAAATTTTTCTGG - Intronic
1192858778 X:75042990-75043012 CTGGATAATAGACCTTTTTCAGG - Intergenic
1195679017 X:107529917-107529939 AAGGTCAATAAACATTTTACTGG - Intronic
1196184417 X:112730721-112730743 CAGGTTAATTGACCTTTTTCTGG + Intergenic
1199945121 X:152659071-152659093 GAAGGAAATAAACATTTTTGGGG - Intergenic
1201185380 Y:11396659-11396681 CTGGGTAAAAAAAATATTTCAGG - Intergenic
1201463548 Y:14255155-14255177 AAGGTAAATAAACATTTGTCGGG + Intergenic