ID: 990518047

View in Genome Browser
Species Human (GRCh38)
Location 5:56549158-56549180
Sequence CAGTATCTGCAGAGGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990518044_990518047 12 Left 990518044 5:56549123-56549145 CCTCAATACAGCATTTTTGTTGG 0: 1
1: 1
2: 2
3: 16
4: 191
Right 990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG 0: 1
1: 0
2: 6
3: 51
4: 468
990518042_990518047 20 Left 990518042 5:56549115-56549137 CCTGACCACCTCAATACAGCATT 0: 1
1: 0
2: 1
3: 16
4: 218
Right 990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG 0: 1
1: 0
2: 6
3: 51
4: 468
990518043_990518047 15 Left 990518043 5:56549120-56549142 CCACCTCAATACAGCATTTTTGT 0: 1
1: 0
2: 2
3: 17
4: 242
Right 990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG 0: 1
1: 0
2: 6
3: 51
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990518047 Original CRISPR CAGTATCTGCAGAGGCAGAG TGG Intronic
900299836 1:1971594-1971616 CAGCATCTGCAAAGGCTCAGAGG - Intronic
901438090 1:9261752-9261774 CAGTATCTACAGAGGCAATCTGG + Intronic
901689947 1:10966245-10966267 CAGTTTCTGCAGAGGAATAATGG + Intronic
901690725 1:10971477-10971499 CAGTATGTGCAGAGGCCCTGAGG - Intronic
901784818 1:11617512-11617534 CAGTAGCTGCTGAGCCAGACTGG - Intergenic
902113769 1:14104353-14104375 CAAGATTTTCAGAGGCAGAGTGG - Intergenic
902225779 1:14995668-14995690 CAGCATCTGCAGGGGCTCAGTGG + Intronic
902534252 1:17110100-17110122 CAGGATCTGCAGGGGCACAATGG - Intronic
902948532 1:19862024-19862046 CAGTATGTGCAAAGGCCCAGAGG - Intergenic
902987826 1:20166209-20166231 CAGACTTTGCAGAGGGAGAGTGG - Intronic
903190055 1:21651319-21651341 CAACAGCTGCAGAGGCAAAGTGG + Intronic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903275620 1:22219479-22219501 CAGTATGTGCAAAGGCCCAGAGG - Intergenic
904254055 1:29243482-29243504 CAGTGTGTGCAAAGGTAGAGAGG - Intronic
904402827 1:30267957-30267979 GAATTTCTGCAGAGGCAGTGGGG - Intergenic
904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG + Intronic
904714659 1:32458235-32458257 CAGAACCTGGAGATGCAGAGGGG + Intergenic
904875571 1:33652054-33652076 CAGTATCTTCAGAGGTAGAGAGG + Intronic
904913370 1:33951880-33951902 CAGCAACTGCAGAGGCCAAGGGG - Intronic
905709173 1:40086296-40086318 CAGCATCTGCAAAGGCAAAAGGG + Intronic
905839504 1:41162677-41162699 AGTTCTCTGCAGAGGCAGAGAGG - Intronic
905879726 1:41455710-41455732 CAGCATCAGCAAAGGCACAGTGG - Intergenic
905974667 1:42165700-42165722 CTGTATCTGCAGGGGCAAGGGGG - Intergenic
906051436 1:42877585-42877607 TAGCAGCTGCAGAGGCACAGTGG + Intergenic
906374282 1:45282072-45282094 CAGTGTATGGAGAGGCACAGAGG - Intronic
906674313 1:47682213-47682235 CAGTAAGTGCAAAGGCACAGAGG - Intergenic
907012854 1:50978911-50978933 CAGCACCTGCAGAAGCACAGTGG + Intergenic
907016389 1:51018330-51018352 CAGCATTTGCAAAGGCAAAGAGG - Intergenic
907377759 1:54057884-54057906 CAGTATATGCAAAGGCACAGAGG - Intronic
907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG + Intergenic
908014109 1:59814478-59814500 CAGTGGCCGAAGAGGCAGAGGGG - Intergenic
908932548 1:69334412-69334434 CAGGATCAGCAGTGGCAGTGTGG + Intergenic
910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG + Intronic
910799759 1:91133352-91133374 AAGTCTCTGCATAGGCAGAGAGG - Intergenic
912236416 1:107855992-107856014 CAGAAGCTGCAGAGGCAGCTAGG + Intronic
912423324 1:109563265-109563287 CAGTTACTCCAGAGGCTGAGGGG + Intronic
912883183 1:113439366-113439388 CAGTATGTGCAAAGGCACAGAGG - Intronic
913321029 1:117588480-117588502 CAGCCTCTACAGACGCAGAGAGG + Intergenic
915578959 1:156801895-156801917 CAGTATTCACAGAGGCAGTGGGG + Intergenic
916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG + Intronic
916204372 1:162301090-162301112 CAGTTTCTGAAGGGGTAGAGAGG - Intronic
917393543 1:174566225-174566247 CAGTAACTGGAGAGGAAGTGAGG + Intronic
917703997 1:177613075-177613097 CAGGATCTGCTGTGGGAGAGAGG - Intergenic
917732745 1:177892155-177892177 CAATCTCTGCACAGGAAGAGGGG - Intergenic
917967519 1:180187810-180187832 CAGTAGCAGCAGAGGCATCGGGG + Intronic
918127200 1:181595276-181595298 AAGTACCTTCAGAGGCAGTGGGG - Intronic
918811508 1:189127443-189127465 CAGTATCTGCAGGGCTTGAGAGG + Intergenic
919682864 1:200453564-200453586 GAGCATCTGCAGAGGAAGAGTGG - Intergenic
919773034 1:201174901-201174923 CAGCATATGCAGAGGCTTAGAGG - Intergenic
920355999 1:205373160-205373182 CAATCTCTGGAGAGCCAGAGGGG - Intergenic
920371506 1:205482080-205482102 GAGTGGCTGCAGAGGCAGACGGG - Intergenic
920992395 1:210952124-210952146 CAGTAGGTGCTGAGGGAGAGAGG - Intronic
1062909168 10:1201251-1201273 CTGCATTTGCAGAGGGAGAGAGG - Intronic
1063299728 10:4840686-4840708 CAGTATTTGCAAAGGCACAGAGG - Intronic
1063698529 10:8361628-8361650 CAGAATGTGCAGAGGAACAGTGG - Intergenic
1064030657 10:11880637-11880659 CAGGATGGGCGGAGGCAGAGCGG - Intergenic
1065297818 10:24293414-24293436 CAGTGCCTGCAGAGGCAGCAAGG - Intronic
1067042156 10:42960710-42960732 CAGTCTCTGCTGAGGCTCAGAGG - Intergenic
1067095818 10:43298838-43298860 CTGTGTCTGCAGTGCCAGAGAGG - Intergenic
1067461980 10:46465077-46465099 CAGCATGTGCAAAGGCACAGAGG + Intronic
1067475052 10:46559327-46559349 CAGCATCTTGGGAGGCAGAGGGG - Intergenic
1067625215 10:47919521-47919543 CAGCATGTGCAAAGGCACAGAGG - Intergenic
1068654561 10:59561361-59561383 AATTATCAGCAGAGGCTGAGTGG - Intergenic
1068752577 10:60612176-60612198 CAGGAGCTGCAGGGGCTGAGTGG + Intronic
1069546177 10:69330499-69330521 CAGTACCTGCAGAACCAGAACGG + Intronic
1070078399 10:73160867-73160889 AAGTATGTGCAAAGGCACAGAGG + Intronic
1071018754 10:81028135-81028157 CAATCTATGCAGAGGAAGAGTGG - Intergenic
1071664211 10:87538047-87538069 CAGTGACTCCAGAAGCAGAGGGG - Intronic
1072061956 10:91821790-91821812 CAGTATGTGTAGAGGCATACAGG + Intronic
1073173687 10:101536129-101536151 AAGTGTCTGCCGTGGCAGAGGGG + Intronic
1073625795 10:105095516-105095538 CACTATCTGCCCAGGCAGATAGG + Intronic
1074229209 10:111516909-111516931 CGGTATCTTGAGAGGGAGAGTGG - Intergenic
1074233550 10:111561991-111562013 CAGCATATGGAAAGGCAGAGGGG - Intergenic
1074310004 10:112313908-112313930 CATTTCCTTCAGAGGCAGAGAGG - Intergenic
1074417336 10:113278665-113278687 GAGGATCTGAAGAGGCAGATGGG + Intergenic
1074562075 10:114543815-114543837 CAATACCTGCAGAGGCTCAGAGG - Intronic
1074945927 10:118280601-118280623 CAGTATCTCCATGGGCAGAATGG - Intergenic
1075698701 10:124454438-124454460 CAGTTTATGCAGAGGGAGTGGGG + Intergenic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1076044755 10:127282857-127282879 CAGTCTCTGCAGAGTGATAGTGG + Intronic
1076278813 10:129227858-129227880 CAGCATCTTGAGAGGCAGAAAGG + Intergenic
1076501020 10:130936159-130936181 CAGTGTCAGCAGAGGCATATGGG - Intergenic
1076778278 10:132709998-132710020 CAGCATCAGCTGAGGCTGAGGGG + Intronic
1076782248 10:132730798-132730820 CAGCCGCTGCAGGGGCAGAGGGG - Intronic
1077024449 11:433005-433027 CAGGATTTGCAGAGGCCCAGGGG - Intronic
1077074122 11:692373-692395 AAGACTTTGCAGAGGCAGAGAGG - Intronic
1077378077 11:2214961-2214983 GAGGATGAGCAGAGGCAGAGTGG - Intergenic
1077552562 11:3207535-3207557 CAGCATATGCACAGGGAGAGGGG - Intergenic
1078107448 11:8367435-8367457 CAGTACCTAAAGAAGCAGAGAGG - Intergenic
1079248993 11:18773494-18773516 CAGAGTCTGCAGACCCAGAGGGG + Intronic
1080603131 11:33840443-33840465 CAGTTACTGGGGAGGCAGAGTGG + Intergenic
1080745970 11:35109072-35109094 CAGTCTCTGCATAGCAAGAGTGG - Intergenic
1080799794 11:35599564-35599586 GAGTTTCTGCAGCTGCAGAGAGG + Intergenic
1081584256 11:44373418-44373440 AAGAATCTGCGGAGGCAAAGAGG + Intergenic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1082654426 11:55836147-55836169 CAAGCTCTCCAGAGGCAGAGGGG + Intergenic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1083346999 11:62000855-62000877 AAGTCTCAACAGAGGCAGAGTGG - Intergenic
1083380888 11:62267697-62267719 CAGTATTTGCAGGGAGAGAGAGG - Intergenic
1084030457 11:66477828-66477850 GAGCATCTCCAGAGGCAGAGAGG + Intergenic
1084589780 11:70084028-70084050 CAGTGTCTGCAAAGGCAAGGAGG + Intronic
1084744987 11:71164316-71164338 CAGTGTCTGTCTAGGCAGAGAGG + Intronic
1085104618 11:73831406-73831428 GAGCATGTGCAAAGGCAGAGAGG - Intronic
1085403707 11:76249451-76249473 CAGTGTCTGCAAAGGCCAAGAGG + Intergenic
1085461379 11:76695932-76695954 CAGCAGGTGCAGAGGCACAGAGG + Intergenic
1085506846 11:77065902-77065924 CAGGATTTGCAGCGGCAGAAAGG - Intergenic
1085882351 11:80482873-80482895 CAGGAAGTCCAGAGGCAGAGTGG - Intergenic
1086248670 11:84787374-84787396 CAGCATTTGCAAAGGCACAGAGG - Intronic
1086787354 11:90985834-90985856 TAATATCTGCAGAAGCACAGAGG - Intergenic
1086911671 11:92479573-92479595 CCTTATCTACAGAGGCAGAATGG - Intronic
1089027836 11:115290161-115290183 CAGTGTCTGCAGAGGCCTGGTGG + Intronic
1089560708 11:119341767-119341789 CAGGCTCTGCGGAGGGAGAGTGG + Exonic
1091479938 12:817485-817507 CAGCATTTGGAGAGGCAGATTGG + Intronic
1091591831 12:1846932-1846954 CTAGATCTGCCGAGGCAGAGAGG - Intronic
1092724112 12:11468092-11468114 CAGCATGTGCAAAGGCACAGTGG - Intronic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1096448979 12:51721529-51721551 CAGTGACTGCAGGGGCAGACAGG - Exonic
1096515536 12:52153227-52153249 CAGGGTCAGCAGAGGCTGAGGGG - Intergenic
1096666538 12:53170088-53170110 GAGGATCTGGAGAGGCAGATTGG - Exonic
1096838528 12:54367179-54367201 CAGTATGTGTAGAGGCGCAGAGG + Intergenic
1097193528 12:57231696-57231718 TAGTATCTGCCGTGGGAGAGGGG - Exonic
1098374147 12:69795364-69795386 AAGTATCAACAGAGTCAGAGGGG - Intronic
1098970165 12:76846098-76846120 TATTATGTGCAGAGGTAGAGAGG + Intronic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1101286039 12:103313717-103313739 CAGGAGCTACAGAGGGAGAGAGG - Intronic
1101321047 12:103673460-103673482 CAGTTACTGCAGAGGCCGAGAGG - Intronic
1101454398 12:104815000-104815022 GAGAATGTGCAAAGGCAGAGAGG - Intronic
1101755344 12:107617072-107617094 GAGGAGCTGCAGAGGAAGAGCGG - Exonic
1102571181 12:113827857-113827879 CAGTAACTGCAGAAACTGAGAGG - Intronic
1102826038 12:115948619-115948641 CAGGATGTGCAAAGGCCGAGAGG + Intergenic
1103219980 12:119235926-119235948 CAGCATATGCAAAGGCACAGAGG - Intergenic
1103256204 12:119543578-119543600 CAGCATGTGCAAAGGCCGAGAGG + Intergenic
1103362917 12:120364265-120364287 CACCCTTTGCAGAGGCAGAGGGG - Intronic
1104268577 12:127261500-127261522 CAGAACCTGCAGAGGCACAGGGG - Intergenic
1105602976 13:21903379-21903401 CAGTATGTGCAGAGGCCGGGGGG - Intergenic
1105978447 13:25494376-25494398 GAGTCTCTGCAGTGGCAGAAAGG - Intronic
1106131469 13:26943164-26943186 CAATATCTGCAGTGGTGGAGAGG - Intergenic
1106443402 13:29801095-29801117 CTGCATCTGCAATGGCAGAGGGG - Intronic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1107868975 13:44729725-44729747 CTGCAGTTGCAGAGGCAGAGTGG + Intergenic
1108211344 13:48142773-48142795 CAATAGAAGCAGAGGCAGAGTGG - Intergenic
1109433414 13:62267009-62267031 CCTTATCTGCAGAGGCCAAGTGG - Intergenic
1110000259 13:70188725-70188747 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1111475403 13:88739576-88739598 CATTATCTTCAGCTGCAGAGTGG + Intergenic
1111781043 13:92724692-92724714 CAGTATTTGCAGGGACTGAGGGG + Intronic
1112078288 13:95936743-95936765 CAGTCTCTGCACAGGCAGGGTGG + Intronic
1113124761 13:106964953-106964975 CTGGATCTTCAGGGGCAGAGGGG - Intergenic
1113874772 13:113587277-113587299 CAGGAACTGCATAGGCACAGGGG + Intronic
1113913622 13:113856829-113856851 CCGTCCCTGCAGAAGCAGAGAGG - Intronic
1114210620 14:20611025-20611047 CAGTTTCTGTAGAGTCAGATTGG - Intergenic
1114515144 14:23294463-23294485 CAGCATTTGCATAGCCAGAGGGG + Intronic
1116764982 14:49059452-49059474 GAGTATATTCAGAGGCAGACAGG + Intergenic
1118009381 14:61593938-61593960 CAGCATATGCAAAGGCAAAGAGG + Intronic
1118487089 14:66224524-66224546 CTGTCTTTGAAGAGGCAGAGGGG + Intergenic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1118729033 14:68653857-68653879 CAGCATGTGCAAAGGCACAGGGG + Intronic
1120018699 14:79503466-79503488 CAGCATGTGCAGAGGCAGAGAGG - Intronic
1120377536 14:83729283-83729305 CTGTACCTGCAGAGCCACAGAGG - Intergenic
1120715880 14:87840293-87840315 CTGTAACTGCAGAGGGAGACTGG - Intronic
1120726612 14:87949186-87949208 CAGTATGTGCAAAGTCACAGAGG + Intronic
1121345757 14:93134737-93134759 CACACTCTGCAGAGTCAGAGAGG + Intergenic
1122183708 14:99972755-99972777 CAGGATCTGGAGAGGAAGGGAGG - Intronic
1122194225 14:100073157-100073179 GAGTGTCAGCAAAGGCAGAGTGG - Intronic
1124623841 15:31297068-31297090 CAGAAAGTGCAGAGGCAGGGTGG + Intergenic
1125160463 15:36637559-36637581 CAGTATCTGCTGAAGTGGAGAGG + Intronic
1126213873 15:46132159-46132181 CAGTCTGTGCAGTGGTAGAGCGG + Intergenic
1127961555 15:63894405-63894427 CAGCATCAGCAGGGTCAGAGAGG + Intergenic
1128452629 15:67814809-67814831 CAGTTTCCTCAGTGGCAGAGTGG + Intergenic
1128462781 15:67883974-67883996 CAGTTTCTGTAGAGGTTGAGTGG + Intergenic
1129002733 15:72347602-72347624 CAGTCTCTGTAGAGGCAGGGAGG + Intronic
1129114629 15:73358332-73358354 CAGTATCTTCAGAGGATGTGAGG - Intronic
1129297544 15:74608230-74608252 CAGAGACTCCAGAGGCAGAGTGG - Intronic
1129526740 15:76222612-76222634 TAGTACCTGCTGAGCCAGAGAGG + Intronic
1130078511 15:80710617-80710639 CAGTATTTGCTGATGCAGAGTGG + Intronic
1130537867 15:84799825-84799847 CAGTACCTGCAGAAGCACAGCGG - Exonic
1131152997 15:90058574-90058596 CAGTGACTGCAGAGGAACAGAGG - Intronic
1131695671 15:94875532-94875554 AAATATCTATAGAGGCAGAGAGG + Intergenic
1132889909 16:2198533-2198555 CAGTTGCTGCACAGGCAGAGAGG - Intergenic
1133161703 16:3916136-3916158 CAGGGTCTGAAGAGCCAGAGGGG - Intergenic
1133721447 16:8498239-8498261 CATGATCTGCAGAAGCAGAGCGG - Intergenic
1134055690 16:11168502-11168524 CAGTGTCTGCAGAGCCAGACAGG - Intronic
1134262175 16:12660199-12660221 CAGTTTCTAGAGAGGCACAGTGG + Exonic
1136515858 16:30768086-30768108 CCGGAGCTGCAAAGGCAGAGAGG - Exonic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141210301 16:81973481-81973503 CAATTTCTGCAGAGGAAGAGTGG - Intergenic
1141352135 16:83307635-83307657 CAGAGTCTGGAGAGGCACAGGGG + Intronic
1142305947 16:89285751-89285773 GTGTCTCTGCAGAGGCAGGGTGG - Intronic
1143113296 17:4565841-4565863 AAGTCTCTGCAGAGGTAAAGAGG + Intergenic
1143917800 17:10306776-10306798 CAGTCTCAGCAGTGGCAAAGTGG - Intronic
1144481762 17:15635750-15635772 CAACATATGCAAAGGCAGAGAGG - Intronic
1144916538 17:18728022-18728044 CAACATATGCAAAGGCAGAGAGG + Intronic
1145004179 17:19328264-19328286 CAGGCTCTGTAGAGGCACAGAGG - Intronic
1145207583 17:20992765-20992787 CAGTGTCTGCATCTGCAGAGTGG - Intergenic
1146002782 17:29141127-29141149 CAGGGACTGCACAGGCAGAGAGG + Intronic
1146501918 17:33372075-33372097 CAGCTTCAGGAGAGGCAGAGAGG - Intronic
1146601620 17:34222030-34222052 CAGTATCTGCAGCTGTAGAGTGG - Intergenic
1146643296 17:34557117-34557139 CAGTATTTGCAGAAGCTGGGAGG + Intergenic
1146651703 17:34611162-34611184 CAGCATGTGCAAAGGCACAGAGG + Intronic
1146706506 17:35004256-35004278 CAATACCTGCAAATGCAGAGGGG - Exonic
1147284954 17:39394844-39394866 CAGTATCTGGCCAGGCACAGTGG - Intronic
1147564619 17:41528535-41528557 CAGGGTCTGCAGAGAGAGAGTGG - Intergenic
1147734691 17:42628299-42628321 CTGTATTTGATGAGGCAGAGAGG - Intergenic
1147964826 17:44188980-44189002 CAGCATCAGCAGAGCCTGAGGGG - Intronic
1148444388 17:47728647-47728669 GAAAGTCTGCAGAGGCAGAGAGG - Intergenic
1148529716 17:48378105-48378127 CAGTGTCTGCAGAGATGGAGAGG - Intronic
1149676752 17:58471698-58471720 CAGCACCTTCAGAGGCTGAGAGG - Intronic
1150271366 17:63867618-63867640 GATTATCTCCAGAGGAAGAGTGG + Intergenic
1150274900 17:63890488-63890510 GATTATCTCCAGAGGAAGAGTGG + Intergenic
1150277033 17:63905254-63905276 GATTATCTCCAGAGGAAGAGTGG + Intergenic
1150543544 17:66129287-66129309 AAGTATTTGGAGAGGTAGAGAGG - Intronic
1150599582 17:66639144-66639166 GAGCAGCTGCAAAGGCAGAGTGG - Intronic
1151209614 17:72534682-72534704 CAGCATATGCAGAGGCACAGAGG - Intergenic
1152459915 17:80437150-80437172 CAGCATCTGCAGAGTCAAGGAGG - Exonic
1152473921 17:80505292-80505314 CAGTGTCTGGAGAGGCAGTGAGG + Intergenic
1152604159 17:81280728-81280750 CACGATCTGCAGAGGGAGAGGGG + Exonic
1154083585 18:11280853-11280875 CTGCATCTGCAGAGGAAGTGCGG + Intergenic
1155205968 18:23558083-23558105 TAGTAAATGCAGAGGAAGAGAGG + Intronic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155439508 18:25847205-25847227 CAGTATCATCTGTGGCAGAGTGG - Intergenic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1156339161 18:36195885-36195907 CTGTATCTGCAGTGACAGTGGGG + Intronic
1156596210 18:38551054-38551076 CACCATCTTCAGAGGCTGAGAGG - Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157478545 18:48038271-48038293 GAGAATCTGCAGGAGCAGAGGGG - Intronic
1157567392 18:48688911-48688933 GAGTGTGTGCAGAGACAGAGAGG - Intronic
1157569032 18:48699961-48699983 CAGTATCTGCCGAGCCAGTGTGG - Intronic
1160144993 18:76356511-76356533 CACTGTCTGCTGAGGCACAGGGG - Intergenic
1160349761 18:78166713-78166735 CAGTATATGTAGATGGAGAGGGG + Intergenic
1160491774 18:79344174-79344196 CATTATTTGCAGAGTCACAGTGG - Intronic
1160842897 19:1154397-1154419 CATGATCTGCAGAGGGAGACGGG + Exonic
1161153903 19:2722516-2722538 AAGTCTCCGCAGAGGCAGATGGG - Intronic
1162724988 19:12684829-12684851 CCGTATGTGAAGATGCAGAGAGG + Intergenic
1163798028 19:19348443-19348465 CTCTAGCTGCAGAGGCACAGGGG - Intronic
1165497754 19:36163613-36163635 CAGTCTGTGCAGAGACTGAGAGG + Intergenic
1166344626 19:42157432-42157454 CACCATCTGGAGATGCAGAGAGG - Intronic
1167172842 19:47844823-47844845 CAGCACTTGCAGAGGCTGAGGGG - Intergenic
1167646782 19:50710323-50710345 CAAGTTCTGCCGAGGCAGAGGGG + Intronic
925265084 2:2561441-2561463 CAGAAGCTGGAGAGGCAGAAAGG + Intergenic
925982671 2:9189917-9189939 CAGTGTGTGCAGAGTCAAAGGGG - Intergenic
926273660 2:11387211-11387233 CAGTATCCGTAGTGGCTGAGTGG + Intergenic
926994981 2:18724961-18724983 CAGTCTAGGAAGAGGCAGAGCGG + Intergenic
927435934 2:23066127-23066149 CAGACTCTGCAGAGTGAGAGGGG - Intergenic
928204061 2:29271647-29271669 GAGGACCTGCAGAGGCAGAATGG + Intronic
928436278 2:31256681-31256703 CTGTGTCTGCAAAGGCTGAGGGG - Intronic
929360790 2:41087833-41087855 AAGTATCTGAAGATGCAGAAAGG - Intergenic
929923520 2:46190770-46190792 TAGTGTTTGCAGTGGCAGAGAGG + Intergenic
931413307 2:62056072-62056094 CAGTATATGCACAGACAGAGTGG + Intronic
931889971 2:66661351-66661373 CAGCAGCTGCAGTGGCAGTGAGG + Intergenic
932809789 2:74815199-74815221 CAGAATCTGCAAATACAGAGGGG - Intergenic
934774350 2:96927648-96927670 CGTTGTCTCCAGAGGCAGAGTGG - Intronic
935106605 2:100050779-100050801 CTGCATCTGCAGGGGCAGTGTGG - Intronic
935578598 2:104736210-104736232 CAGTCTCTGCTGAGGCAAAGCGG - Intergenic
935697300 2:105781297-105781319 CAGGACCTGCAAAGGCACAGAGG - Intronic
936744390 2:115557164-115557186 CAGTATGTACAGAGAGAGAGAGG - Intronic
936798577 2:116237741-116237763 CAGAATACGCACAGGCAGAGCGG - Intergenic
936913488 2:117616092-117616114 CAGTACTGGCAGAAGCAGAGTGG - Intergenic
937040531 2:118817247-118817269 CAGCATGTGCAAAGGCAGGGAGG - Intergenic
937553719 2:123128796-123128818 CAAAATCTGCAGAGACAGACAGG + Intergenic
937680533 2:124639937-124639959 GAGTATCTGCAGCAGCAAAGGGG - Intronic
938376268 2:130808710-130808732 AGTGATCTGCAGAGGCAGAGTGG - Intergenic
938885023 2:135637304-135637326 CAGTATGTACAGAGGCCCAGAGG + Intronic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939377083 2:141382334-141382356 CAGTATCTGCTGTGGCACAGAGG - Intronic
939834182 2:147107913-147107935 CCGTATCTGTGGAGGCACAGAGG + Intergenic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
940236490 2:151516460-151516482 GAGTCTCAGCAGATGCAGAGTGG - Exonic
942699474 2:178688205-178688227 AAGTATCTGCAGAGGAGGAATGG - Exonic
943248403 2:185485141-185485163 CTGTACCTGCAGAGCCACAGGGG + Intergenic
943727472 2:191267089-191267111 TTGTCTCTGCATAGGCAGAGAGG - Intronic
944968901 2:204968591-204968613 CAGTATCTGCAAAGGCACAGAGG - Intronic
945413285 2:209538689-209538711 TATTAACTGCAGAGGCAGAAGGG - Intronic
945946633 2:216001523-216001545 CTGGGTCTGGAGAGGCAGAGGGG - Intronic
946235252 2:218320737-218320759 CAGTATGTGCAAAGGCATGGGGG + Intronic
946591520 2:221254504-221254526 GAGTATGTGCAGATGCAGGGAGG + Intergenic
947715724 2:232338027-232338049 AAGTATCTGCAGGGACAGACAGG + Intronic
947721258 2:232370404-232370426 AAGTATCTGCAGGGACAGACAGG + Intergenic
947734753 2:232448787-232448809 AAGTATCTGCAGGGACAGACAGG + Intergenic
947959606 2:234224699-234224721 CAGAATCTGCAGAAAGAGAGGGG - Intergenic
948051513 2:234982648-234982670 CAGTTTTTGCACAGGCAGGGAGG + Intronic
948338750 2:237232154-237232176 AAGCATCTGGAGAGGGAGAGGGG - Intergenic
948710106 2:239820026-239820048 CAGGGTCTGCAGGGGCAAAGGGG + Intergenic
1168842254 20:916962-916984 CTGTGTCTCCAGAGGCAAAGTGG - Intergenic
1168856473 20:1012804-1012826 CAGTAAATGCAGAGGCCCAGAGG + Intergenic
1168869406 20:1115677-1115699 CAGTATGTGCAAAGGCATGGTGG - Intronic
1169020969 20:2330542-2330564 AGTCATCTGCAGAGGCAGAGAGG - Intronic
1170509326 20:17060441-17060463 CAGTATGTGCAAATGCACAGAGG + Intergenic
1171065295 20:22009214-22009236 CAGTTACTCCAGAGGCTGAGGGG - Intergenic
1172182270 20:33010780-33010802 CAGGATTTTGAGAGGCAGAGTGG + Intronic
1172214556 20:33225791-33225813 CAGCATGTGCAAAGGCACAGTGG - Intronic
1172463605 20:35138348-35138370 CAGTATCTTCATACGAAGAGGGG - Intronic
1172962771 20:38810188-38810210 CAGCATGTGCAGAGGCACCGAGG + Intronic
1173713254 20:45178943-45178965 CAGGATCTGCTGTGGCACAGTGG + Intergenic
1173808979 20:45944877-45944899 GAGCATCTGCGGAGGCAGTGTGG + Exonic
1174850060 20:53985299-53985321 CAGTTTGCCCAGAGGCAGAGAGG + Exonic
1175269445 20:57723534-57723556 CAGGAGCTGCAGAGGCAGGTGGG + Intergenic
1175328785 20:58148410-58148432 AGGGATCTGCAGAGGCTGAGAGG - Intergenic
1175403805 20:58714729-58714751 CAGCAGCTCCAGAGCCAGAGGGG - Intronic
1175411806 20:58775317-58775339 CAGCATCTGCATAGGAATAGGGG - Intergenic
1177215514 21:18123308-18123330 CCGTATCTACAGGAGCAGAGTGG - Intronic
1178809610 21:35869350-35869372 CAGAACCTGCAGAGGCAGTAGGG - Intronic
1179138033 21:38697821-38697843 GAGTAGCTGGAGGGGCAGAGTGG - Intergenic
1181552546 22:23649070-23649092 CAGGGACTGGAGAGGCAGAGCGG - Intergenic
1182014382 22:27026738-27026760 CAGTAACTGCAAAGGCAGAAAGG + Intergenic
1182035237 22:27193066-27193088 CAGCATCTGCTGAGTCAGATCGG - Intergenic
1182072261 22:27472055-27472077 CAATATAGGCAAAGGCAGAGAGG - Intergenic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1183061589 22:35339554-35339576 AAGTCTCTAGAGAGGCAGAGAGG - Intronic
1183404085 22:37621599-37621621 CAGCATCTGCAGAGACAGAGGGG - Exonic
1183475792 22:38035031-38035053 CAGGATTTGCAGAGGCCAAGAGG - Intronic
1183762310 22:39832967-39832989 CAGTCTGTGCAGAAGCCGAGTGG + Intronic
1184569213 22:45311234-45311256 CAGTATGTCAAAAGGCAGAGAGG + Intronic
1184719151 22:46299439-46299461 CAGGGTATGCAGATGCAGAGGGG - Intronic
1203296105 22_KI270736v1_random:44445-44467 CAGAAGCAGCACAGGCAGAGGGG - Intergenic
949216390 3:1574201-1574223 CAGTATATGCAAAGGCACAAAGG - Intergenic
950387547 3:12672096-12672118 CAGTATGGGCAAAGGCATAGAGG + Intergenic
950507998 3:13407600-13407622 CAGCATCAGCAGAGGAATAGAGG - Intronic
950720712 3:14880725-14880747 ACGTATCTGCAGAGGGAAAGAGG - Exonic
951275429 3:20679398-20679420 TAGCATGTGCAAAGGCAGAGAGG + Intergenic
952272491 3:31846769-31846791 CAGAAGCTGCAGAGAAAGAGAGG - Intronic
952354942 3:32575314-32575336 CAGTTTCTGTAGAGTCATAGGGG - Intergenic
952359454 3:32615263-32615285 TATTATCTCCAGAGCCAGAGGGG - Intergenic
952914420 3:38222471-38222493 CATTATCTGCAAGAGCAGAGTGG + Intronic
952933558 3:38377873-38377895 CAGCAGCTTCAGAGCCAGAGAGG - Intronic
953046643 3:39298719-39298741 CAGTAGCTGCAGTGGCAGGCTGG - Intergenic
953085645 3:39664106-39664128 CAGTATCTCCAAGGGCAAAGAGG - Intergenic
953688600 3:45098051-45098073 CAGGGACTGCAGAAGCAGAGGGG - Intronic
954652088 3:52171290-52171312 CAGTGGAAGCAGAGGCAGAGAGG - Intergenic
955027156 3:55179546-55179568 CAGCAAATGCAAAGGCAGAGAGG + Intergenic
955040261 3:55309877-55309899 CAGGTTCTGGAGATGCAGAGGGG + Intergenic
955485496 3:59430546-59430568 CATTATCTGCAGAGGAAAATTGG + Intergenic
955798976 3:62666920-62666942 CAGTTTCTGCATCTGCAGAGTGG + Intronic
956055701 3:65296418-65296440 CAGAATCTCAACAGGCAGAGTGG + Intergenic
958513960 3:95088439-95088461 CATTAACTGCAGAAGCAGTGTGG - Intergenic
959563665 3:107812468-107812490 CAGTATATGCAGAAGTAGAGAGG + Intergenic
959685267 3:109139218-109139240 CAGTCACTGCAGTGCCAGAGGGG - Intergenic
961054523 3:123776887-123776909 CAGGATCTACAGGGGCATAGTGG - Intronic
961103436 3:124221210-124221232 CAGTACATGCCAAGGCAGAGAGG - Intronic
961658524 3:128456325-128456347 CAGCATCTGCAAAGGTAGAAGGG + Intergenic
961818387 3:129562938-129562960 CAGGTTCTGCAGGGGGAGAGTGG + Exonic
962218079 3:133540102-133540124 CAAAATCCCCAGAGGCAGAGGGG - Intergenic
963083343 3:141414867-141414889 AAGTGTCAACAGAGGCAGAGAGG - Intronic
963307722 3:143672294-143672316 AACTAAATGCAGAGGCAGAGAGG + Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
963853081 3:150226902-150226924 CAGTATCTTCAGAACTAGAGAGG + Intergenic
965519591 3:169659346-169659368 CATTAGCTGTAGAGGCAGAAAGG - Intronic
966157730 3:176935264-176935286 CATCTGCTGCAGAGGCAGAGAGG + Intergenic
966921341 3:184613607-184613629 CAGGATGTGCAAATGCAGAGAGG + Intronic
967189047 3:186969689-186969711 CAGGAAGTGCAGAGGAAGAGCGG + Intronic
967333467 3:188316835-188316857 CACTAGCTGCAGAGACAGAAAGG - Intronic
968278049 3:197455996-197456018 CAGTATCTCCTCTGGCAGAGTGG + Intergenic
968711732 4:2124525-2124547 CAGTATTTGGGGAGGCAAAGAGG - Intronic
969220038 4:5753342-5753364 CAGGAACTGCAGAGGGACAGAGG + Intronic
969377381 4:6771777-6771799 CAGCATTTGCAAAGGCAGAGAGG + Intergenic
971066134 4:23035416-23035438 CAGTCTCTGTACAGGAAGAGTGG + Intergenic
971154638 4:24068332-24068354 CAGTATCTGCAGAAGCCCAGAGG + Intergenic
972118246 4:35665735-35665757 CAGTCTCTTCAGAGGCTGAGAGG - Intergenic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
972596810 4:40536680-40536702 CAAAAACTGCAAAGGCAGAGAGG - Intronic
973766557 4:54168381-54168403 CAGCGTTAGCAGAGGCAGAGTGG - Intronic
973897937 4:55434926-55434948 CATTATCTGAAAAGGGAGAGGGG + Exonic
974906347 4:68063188-68063210 AAGTATCTCCAGAGGCAGTTGGG - Intronic
976077538 4:81316648-81316670 CAGGTTCTAAAGAGGCAGAGGGG + Intergenic
977490594 4:97705190-97705212 CAGTATATGCAAAGTCAAAGAGG - Intronic
977971440 4:103218283-103218305 CTGCAACTGCAGTGGCAGAGGGG - Intergenic
980097822 4:128511580-128511602 CCTTATATGCAGAGGTAGAGGGG + Intergenic
980859561 4:138482826-138482848 CTGGCTCTGCAGAGGTAGAGAGG - Intergenic
981639822 4:146928186-146928208 GAGTATTTTCAGAGGCAGAATGG + Intronic
981660247 4:147158227-147158249 CAGTTTGTGCAGTGCCAGAGTGG - Intergenic
981724474 4:147833130-147833152 CAGTATTTTCAGTGGCACAGAGG + Intronic
982854312 4:160362172-160362194 CTGTATCTGCAAAGCCACAGGGG - Intergenic
983269879 4:165548917-165548939 CAGAAGCTTCAGAGGAAGAGAGG - Intergenic
983899822 4:173122094-173122116 CAGTGTGTGCAAAGGCACAGAGG - Intergenic
984171764 4:176368247-176368269 CAATCTCTGCAGAGGAAGGGTGG + Intergenic
984600498 4:181721142-181721164 CATTATGTACAAAGGCAGAGAGG + Intergenic
984652469 4:182285426-182285448 CAGTATCAGCAGACACATAGTGG - Intronic
985201480 4:187489172-187489194 CTGTACCTGCAGAGCCACAGGGG + Intergenic
985477859 5:89981-90003 CAGGACCTGTAAAGGCAGAGGGG - Intergenic
985714549 5:1448097-1448119 CAGGAAGTGCAGAGGCAGGGGGG - Intergenic
986350262 5:6871307-6871329 CAGTGTATGCACAGACAGAGTGG - Intergenic
987588660 5:19893129-19893151 CTGTGTCCTCAGAGGCAGAGGGG - Intronic
987739474 5:21887524-21887546 CAGTGTCTCCAGAGGAAGAATGG - Intronic
988854079 5:35210105-35210127 CAGTACCTGCAAAGGCACTGAGG - Intronic
989160309 5:38384645-38384667 CAGTCTGTGCAGTGACAGAGTGG + Intronic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
990629266 5:57650504-57650526 GACTATCTGCAGAAGCAGATGGG + Intergenic
990647482 5:57860700-57860722 CAGGATGTGCAGAGGCACAAAGG + Intergenic
991473355 5:66993640-66993662 CAGGATGTGCAAAGGCAGTGAGG + Intronic
991499406 5:67261864-67261886 CTGTCTCTGGAGTGGCAGAGGGG + Intergenic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
992118704 5:73567996-73568018 CAATAGCTGAAGAGACAGAGTGG + Intronic
992879167 5:81088137-81088159 CAGTCTGTGCAGAGGAATAGAGG - Intronic
993763319 5:91823722-91823744 CAGTATCTAAAGAGGCAGAAAGG - Intergenic
993971910 5:94429941-94429963 CAGAATCTGCACAGGAAGGGTGG + Intronic
994261676 5:97666474-97666496 CAGTATCTGCAAAGGCAGCACGG + Intergenic
994392444 5:99203575-99203597 CAGAATATTCAGAGGAAGAGAGG - Intergenic
997900446 5:137758883-137758905 CAGTATATGCACAGACAGAGTGG - Intergenic
998747988 5:145283511-145283533 CAGCAAATGCAGAGGGAGAGGGG - Intergenic
999371588 5:151058625-151058647 CAGAACTTGCAGAGGCAGAGAGG - Intronic
999542070 5:152584788-152584810 CTGCAGCTGCAGTGGCAGAGGGG + Intergenic
999874590 5:155788757-155788779 CTTTATTTGCAGAGGCAGATAGG + Intergenic
1000102864 5:158033622-158033644 CAGCATCCCCAGAGCCAGAGTGG + Intergenic
1000149922 5:158489914-158489936 CAGTATGTGCAAAGGCCTAGAGG + Intergenic
1000616320 5:163431974-163431996 CAGTATCTGATGCTGCAGAGAGG - Intergenic
1001251859 5:170152855-170152877 GAGGATCTGGAGAGGAAGAGAGG - Intergenic
1001286995 5:170431044-170431066 CAGCATCTGCAGATGGAGTGAGG - Intronic
1001318229 5:170659633-170659655 AAGAATTTGCAGAGGCAGTGAGG + Intronic
1001664511 5:173421392-173421414 CAGTACCAGCAGACCCAGAGAGG - Intergenic
1002174733 5:177395398-177395420 CAGTATGTGCAAAGGCTCAGAGG + Intronic
1002517470 5:179770111-179770133 CAGGAGCTGGAGAGGCAGGGTGG - Intronic
1002556973 5:180049827-180049849 CAATATATTCAGAGGCAGAAAGG - Intronic
1003047185 6:2744632-2744654 CAGGATGTGCAGAGGGACAGTGG - Intronic
1003055037 6:2810355-2810377 CAGTCTCTGCTGAGACAGAAAGG + Intergenic
1003393495 6:5733131-5733153 CAATCTCCGCAGAGGCAGAAGGG - Intronic
1003909205 6:10728027-10728049 CAGTATATGCAGAGGCCCTGTGG - Intronic
1003912423 6:10754426-10754448 CAGTATATGCAGAGGCCCTGTGG - Intronic
1004264726 6:14139200-14139222 GATTGTCTGCAGAGGCAGATGGG + Intergenic
1004366049 6:15013606-15013628 CAGTATGGGCAAAGGCAGAGAGG - Intergenic
1004453756 6:15771833-15771855 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1005243767 6:23858655-23858677 AAGTATGTGCAAAGGCACAGAGG - Intergenic
1005650631 6:27881737-27881759 CAGCAACTCCAGAGGCTGAGGGG + Intergenic
1006339287 6:33437799-33437821 CGGTGTCCCCAGAGGCAGAGCGG - Exonic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1007016425 6:38472022-38472044 CATTTTCTACAGAGGCAAAGTGG - Intronic
1008294143 6:49756256-49756278 CTCTCTCTGCAGTGGCAGAGAGG + Intergenic
1009047610 6:58248847-58248869 CATAATATGCAGAGGGAGAGAGG + Intergenic
1010354451 6:74915087-74915109 CAGCACATGCAAAGGCAGAGAGG - Intergenic
1010386988 6:75291478-75291500 CAGTATCTACAGAGGCATTTGGG - Intergenic
1010519619 6:76817601-76817623 CTGTGTCTGCAGGGGCAGGGAGG - Intergenic
1011071778 6:83393020-83393042 CAGCACCAGTAGAGGCAGAGAGG - Intronic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011782180 6:90801812-90801834 CAGCATCAGCAAAGGCACAGAGG + Intergenic
1011957207 6:93037744-93037766 CAGTCTCTGCACAGGAAGGGTGG + Intergenic
1013437210 6:110122519-110122541 CAGGAGTAGCAGAGGCAGAGAGG - Intronic
1014190944 6:118496051-118496073 CAGTATACGCACAGACAGAGAGG + Intronic
1017132357 6:151118582-151118604 CAGAAGCTGCACAGGCTGAGAGG - Intergenic
1017494318 6:154969988-154970010 CAGTCTCTCCACAGCCAGAGAGG - Intronic
1018093911 6:160368092-160368114 CAGAGTCTGGAGAGCCAGAGTGG - Intronic
1018441232 6:163815278-163815300 CAGTCACTGCAGAGGCAATGAGG + Intergenic
1019096022 6:169579784-169579806 CGGTAGCTGCACAGGCAGAGTGG - Intronic
1021629042 7:22625476-22625498 CCCTGTCAGCAGAGGCAGAGAGG + Intronic
1021959019 7:25853962-25853984 CGGTATTTGCAGAGGGAGACGGG - Intergenic
1022390626 7:29940866-29940888 CACTCTCTGCAGAGGGAGTGAGG - Exonic
1022472480 7:30690294-30690316 CAGCATGTGCAAAGGCAGAGAGG + Intronic
1022901254 7:34812579-34812601 CTGGATTTGAAGAGGCAGAGAGG + Intronic
1023851016 7:44150408-44150430 CAGTCCCTACAGAGACAGAGAGG - Intronic
1023999867 7:45183140-45183162 TAGTACCTGCAAAAGCAGAGGGG - Exonic
1024160846 7:46673910-46673932 GAGTGTCTGCAAAGGCCGAGAGG - Intronic
1024318384 7:48042438-48042460 CAGCATCTGCTGAGGTATAGGGG + Intronic
1025110708 7:56213808-56213830 CAGTAGCTCCAGAGGCTGTGTGG + Intergenic
1026431602 7:70352948-70352970 CAGCATCTGCAGAGGCTCTGAGG + Intronic
1027744233 7:82053636-82053658 ACGTATCTCCAGAAGCAGAGTGG + Intronic
1027770656 7:82402199-82402221 CAGCATATGCAAAGTCAGAGAGG + Intronic
1028616020 7:92767743-92767765 CAGTATGTGTGGGGGCAGAGGGG + Intronic
1028826902 7:95284015-95284037 CAGGATCTTCAGAGGCAGACTGG + Exonic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1029216273 7:98952663-98952685 CAGTATTTGAAGGGGAAGAGTGG + Intronic
1030082054 7:105786631-105786653 CAGCTACTGGAGAGGCAGAGGGG - Intronic
1030754176 7:113268557-113268579 CAGTCTCTGCACAGGAAGGGTGG - Intergenic
1030821257 7:114094773-114094795 CAGCTACTGCAGAGGCTGAGGGG - Intronic
1031923450 7:127617858-127617880 TTGTAGCTGCAAAGGCAGAGTGG + Intergenic
1032458952 7:132095168-132095190 CCCTATCTGGAGAGGCTGAGGGG - Intergenic
1032475137 7:132206743-132206765 AGCTGTCTGCAGAGGCAGAGAGG - Intronic
1033155940 7:138957107-138957129 CAGCATGTGCAAAGGCACAGGGG + Intronic
1033445237 7:141415560-141415582 CAGCATCTCCAGGGGCCGAGAGG + Intronic
1033589892 7:142800538-142800560 CAGTTTCTGCAAAGTCAGAATGG + Intergenic
1036645379 8:10609005-10609027 CAGATTCTGCAGAGGAAGAGGGG - Exonic
1037903839 8:22703799-22703821 CAGTCTCTGAGGAGGCCGAGCGG - Intergenic
1037996980 8:23359860-23359882 CAGCATGGGCAGAGGCACAGAGG - Intronic
1038392052 8:27211077-27211099 CAGAATCTGTGGATGCAGAGGGG - Intergenic
1039197409 8:35048014-35048036 CAGACTCTGCAGAGCCAGAGAGG - Intergenic
1039574425 8:38611914-38611936 TAGAATTTGCATAGGCAGAGAGG + Intergenic
1042651399 8:71045888-71045910 CAGTAGCTGCAGAAGGAAAGAGG + Intergenic
1042711075 8:71718351-71718373 AAGTATCTCCAGTGGCAGAGAGG - Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1044719317 8:95130513-95130535 CAGTTACTGAAGAGGCTGAGAGG + Intergenic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1047521922 8:125601569-125601591 CAGCATTTGCAAAGGCACAGAGG + Intergenic
1048001492 8:130383003-130383025 CAGCATGTGCAAAGGCACAGAGG + Intronic
1049188034 8:141269395-141269417 GTGAATCTGCAGCGGCAGAGGGG + Intronic
1049251887 8:141593585-141593607 CAGTGTCTGCACAGGCAAGGTGG + Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1049938922 9:526047-526069 CATTCTCCTCAGAGGCAGAGAGG - Intronic
1051053730 9:12958930-12958952 CTTTAGCTGCAGAGGCAGTGTGG + Intergenic
1051952413 9:22652103-22652125 CAGTATTTGAAGTGGCAGATAGG - Intergenic
1052489359 9:29144586-29144608 CAGTAATTTCAGAGGCAGGGTGG + Intergenic
1052727000 9:32240849-32240871 CAGTTACTCAAGAGGCAGAGAGG + Intergenic
1053385420 9:37683579-37683601 CAGTATCTGCAGAGACACGAGGG + Intronic
1054450737 9:65402379-65402401 CAGAACCTTCAGAGGCAGCGCGG - Intergenic
1054803891 9:69379779-69379801 TAGTTTCTGCAGTGGCAGAAAGG + Intronic
1054972307 9:71102555-71102577 GAGTATGTGCAGAAGCAGTGTGG - Intronic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055830153 9:80368672-80368694 CAGAATCTGCGGATACAGAGGGG - Intergenic
1057004945 9:91548846-91548868 AATTATCTGCAGAGGATGAGAGG + Intergenic
1058328960 9:103734912-103734934 CAGCAACTGCAGAGGGATAGTGG - Intergenic
1058485725 9:105441862-105441884 GAGTATATGCAGAGGGATAGGGG + Intergenic
1059025241 9:110620540-110620562 CAGCATCTCCAGAGCCAGATGGG - Intergenic
1059185140 9:112261503-112261525 TAGTATGTGCAGAGTCATAGAGG - Intronic
1060023053 9:120148895-120148917 TGGCATCTGCAGAGGCTGAGAGG + Intergenic
1061133748 9:128722019-128722041 CAGTATCTGCAGCGCCGAAGAGG + Exonic
1061352621 9:130077710-130077732 TAGTCTATGCAAAGGCAGAGTGG + Intronic
1062236046 9:135508144-135508166 CAGAATGTGGAGAGGCACAGAGG + Intergenic
1062528874 9:136991106-136991128 CAGCATGTGCAGAGGCCCAGGGG + Intergenic
1062632328 9:137469384-137469406 CTGTATCTGAAGAGACAGTGTGG + Intronic
1186270501 X:7881685-7881707 TAGTATCTGAAGAGGCAGAAAGG - Intergenic
1186277714 X:7957830-7957852 GAGTTTGTGCAAAGGCAGAGAGG - Intergenic
1187249969 X:17588311-17588333 AAGTAGCTGCAGAGCCAGACTGG - Intronic
1188591379 X:31840526-31840548 CAGTATCTGCAGAGCCAATAAGG - Intronic
1188600433 X:31956995-31957017 CAGTGTCTGCAGTGGTAGAGTGG + Intronic
1189943021 X:46146543-46146565 CAGCTACTCCAGAGGCAGAGCGG - Intergenic
1190753482 X:53381445-53381467 CAGCATGTGCAGAGGCAAGGAGG - Intronic
1190912683 X:54787248-54787270 CAGCATGTGCAGAGGCACAGAGG - Intronic
1193352211 X:80476756-80476778 CTGTATCTGCAGTAGCAGTGAGG + Intergenic
1193509762 X:82384461-82384483 CAGGATCTGCTGAGGGAGGGAGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1194570804 X:95552360-95552382 CACTATCTGCAGTGGTAAAGAGG - Intergenic
1196711918 X:118771344-118771366 AATTATCTGCAGAGGCATGGAGG + Intronic
1198012058 X:132567246-132567268 AAGTAGCTGCAGAGGCAGGTGGG + Intergenic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198853789 X:140994935-140994957 CAGGATATGCAAAGGCAGAGAGG - Intergenic
1198979328 X:142377136-142377158 CAGTATGTGCAGAGGCTCTGGGG + Intergenic
1199380367 X:147165270-147165292 CAGCATCTGCTGTGGGAGAGGGG + Intergenic
1200716999 Y:6558003-6558025 CAGTATCTTCAAAGGTAGAAAGG + Intergenic
1201148613 Y:11081944-11081966 CAGTGTCTGTCTAGGCAGAGGGG + Intergenic