ID: 990519923

View in Genome Browser
Species Human (GRCh38)
Location 5:56569465-56569487
Sequence ATCCATCTGGTTATTGCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990519920_990519923 19 Left 990519920 5:56569423-56569445 CCTTAATTAGAAAACAAAACAAA 0: 1
1: 1
2: 43
3: 425
4: 3811
Right 990519923 5:56569465-56569487 ATCCATCTGGTTATTGCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990519923 Original CRISPR ATCCATCTGGTTATTGCTAG TGG Intronic
No off target data available for this crispr