ID: 990535317

View in Genome Browser
Species Human (GRCh38)
Location 5:56715928-56715950
Sequence CTGTTGTAAGAGAGGAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990535313_990535317 1 Left 990535313 5:56715904-56715926 CCTAATTCCATTAGTTGGAAGAA No data
Right 990535317 5:56715928-56715950 CTGTTGTAAGAGAGGAAAGGAGG No data
990535314_990535317 -6 Left 990535314 5:56715911-56715933 CCATTAGTTGGAAGAAACTGTTG No data
Right 990535317 5:56715928-56715950 CTGTTGTAAGAGAGGAAAGGAGG No data
990535312_990535317 2 Left 990535312 5:56715903-56715925 CCCTAATTCCATTAGTTGGAAGA No data
Right 990535317 5:56715928-56715950 CTGTTGTAAGAGAGGAAAGGAGG No data
990535311_990535317 3 Left 990535311 5:56715902-56715924 CCCCTAATTCCATTAGTTGGAAG No data
Right 990535317 5:56715928-56715950 CTGTTGTAAGAGAGGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990535317 Original CRISPR CTGTTGTAAGAGAGGAAAGG AGG Intergenic
No off target data available for this crispr