ID: 990537621

View in Genome Browser
Species Human (GRCh38)
Location 5:56738434-56738456
Sequence TGACAAGTATTCAACCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990537618_990537621 14 Left 990537618 5:56738397-56738419 CCTTTTGCATCAAAGACAGGTTT No data
Right 990537621 5:56738434-56738456 TGACAAGTATTCAACCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990537621 Original CRISPR TGACAAGTATTCAACCTGAC TGG Intergenic
No off target data available for this crispr