ID: 990540924

View in Genome Browser
Species Human (GRCh38)
Location 5:56771710-56771732
Sequence CAGCTGATCCTGGGGATCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990540924_990540929 -3 Left 990540924 5:56771710-56771732 CCCGGGATCCCCAGGATCAGCTG No data
Right 990540929 5:56771730-56771752 CTGCTCCACATTAGAGATTAAGG No data
990540924_990540932 5 Left 990540924 5:56771710-56771732 CCCGGGATCCCCAGGATCAGCTG No data
Right 990540932 5:56771738-56771760 CATTAGAGATTAAGGGTTTCTGG No data
990540924_990540930 -2 Left 990540924 5:56771710-56771732 CCCGGGATCCCCAGGATCAGCTG No data
Right 990540930 5:56771731-56771753 TGCTCCACATTAGAGATTAAGGG No data
990540924_990540935 28 Left 990540924 5:56771710-56771732 CCCGGGATCCCCAGGATCAGCTG No data
Right 990540935 5:56771761-56771783 ACATAAGGCAGGTGAAACAGAGG No data
990540924_990540933 13 Left 990540924 5:56771710-56771732 CCCGGGATCCCCAGGATCAGCTG No data
Right 990540933 5:56771746-56771768 ATTAAGGGTTTCTGGACATAAGG No data
990540924_990540934 17 Left 990540924 5:56771710-56771732 CCCGGGATCCCCAGGATCAGCTG No data
Right 990540934 5:56771750-56771772 AGGGTTTCTGGACATAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990540924 Original CRISPR CAGCTGATCCTGGGGATCCC GGG (reversed) Intergenic
No off target data available for this crispr