ID: 990544663

View in Genome Browser
Species Human (GRCh38)
Location 5:56810877-56810899
Sequence TGGCCAAAGCTGCTATAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990544663_990544666 9 Left 990544663 5:56810877-56810899 CCTCTTTATAGCAGCTTTGGCCA No data
Right 990544666 5:56810909-56810931 GGAAATCAATTGCAAAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990544663 Original CRISPR TGGCCAAAGCTGCTATAAAG AGG (reversed) Intergenic
No off target data available for this crispr