ID: 990545406

View in Genome Browser
Species Human (GRCh38)
Location 5:56816224-56816246
Sequence GCGCCCCGGACCCAGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 252}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990545395_990545406 1 Left 990545395 5:56816200-56816222 CCCCGACCCCTTCGGAGTCGGGC 0: 1
1: 0
2: 0
3: 0
4: 28
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545388_990545406 12 Left 990545388 5:56816189-56816211 CCCTGAGCACCCCCCGACCCCTT 0: 1
1: 0
2: 0
3: 22
4: 211
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545396_990545406 0 Left 990545396 5:56816201-56816223 CCCGACCCCTTCGGAGTCGGGCG 0: 1
1: 0
2: 0
3: 5
4: 36
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545391_990545406 3 Left 990545391 5:56816198-56816220 CCCCCCGACCCCTTCGGAGTCGG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545397_990545406 -1 Left 990545397 5:56816202-56816224 CCGACCCCTTCGGAGTCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 75
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545393_990545406 2 Left 990545393 5:56816199-56816221 CCCCCGACCCCTTCGGAGTCGGG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545386_990545406 19 Left 990545386 5:56816182-56816204 CCTACGCCCCTGAGCACCCCCCG 0: 1
1: 0
2: 2
3: 15
4: 201
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545385_990545406 25 Left 990545385 5:56816176-56816198 CCGGGACCTACGCCCCTGAGCAC 0: 1
1: 0
2: 0
3: 14
4: 93
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545389_990545406 11 Left 990545389 5:56816190-56816212 CCTGAGCACCCCCCGACCCCTTC 0: 1
1: 0
2: 0
3: 39
4: 294
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545399_990545406 -5 Left 990545399 5:56816206-56816228 CCCCTTCGGAGTCGGGCGGCGCC 0: 1
1: 0
2: 0
3: 3
4: 33
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545387_990545406 13 Left 990545387 5:56816188-56816210 CCCCTGAGCACCCCCCGACCCCT 0: 1
1: 0
2: 8
3: 48
4: 761
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545400_990545406 -6 Left 990545400 5:56816207-56816229 CCCTTCGGAGTCGGGCGGCGCCC 0: 1
1: 0
2: 0
3: 3
4: 19
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252
990545401_990545406 -7 Left 990545401 5:56816208-56816230 CCTTCGGAGTCGGGCGGCGCCCC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG 0: 1
1: 0
2: 4
3: 26
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990545406 Original CRISPR GCGCCCCGGACCCAGCCTGG GGG Intronic
900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG + Intronic
900467452 1:2832792-2832814 GAGCCCCAGACCCAGGCTGGAGG - Intergenic
901063731 1:6485384-6485406 CAGCCCCGGGCCCGGCCTGGAGG + Intronic
901065100 1:6490657-6490679 TCTCCCCGGTCCCAGCCGGGCGG - Intronic
902990886 1:20186259-20186281 CCTCCCCAGACCCAGCCCGGGGG + Intronic
903325183 1:22565275-22565297 GAGCCCAGGGCCCAGCATGGAGG + Intronic
903347072 1:22693354-22693376 TCACCCAGGACCCAGGCTGGAGG - Intergenic
904181520 1:28669295-28669317 GCTCCCCGGACCCCGCCTTTGGG - Intronic
907318463 1:53587779-53587801 GACCCCAGGACCCAGCCAGGGGG + Intronic
914682732 1:149950832-149950854 GCGCCACTGCTCCAGCCTGGGGG - Intronic
916005745 1:160658527-160658549 GCGCCCCAGGCCAAGGCTGGAGG - Intergenic
916107151 1:161440781-161440803 CCGCCTCGGACCCAGCCTGTGGG - Intergenic
916108738 1:161448199-161448221 CCGCCTCGGACCCAGCCTGTGGG - Intergenic
916110326 1:161455580-161455602 CCGCCTCGGACCCAGCCTGTGGG - Intergenic
916111911 1:161462990-161463012 CCGCCTCGGACCCAGCCTGTGGG - Intergenic
916113498 1:161470371-161470393 CCGCCTCGGACCCAGCCTGTGGG - Intergenic
916179136 1:162069509-162069531 TCGCCCCGGCCCCAGACTGCCGG - Intergenic
920376684 1:205512554-205512576 GCCTCCTGGGCCCAGCCTGGTGG + Intronic
922241161 1:223756228-223756250 GTGCCCCAGCCCCAGCCTGAGGG - Intronic
922792268 1:228317012-228317034 GCGCCCCAGACCCGACCTGCAGG - Intronic
1062992281 10:1831378-1831400 GTGGCCCCTACCCAGCCTGGAGG - Intergenic
1064859826 10:19815751-19815773 GCGCCCCGCCCCGACCCTGGCGG - Intergenic
1066653184 10:37678871-37678893 TCGCCCCTGATCCAGTCTGGGGG - Intergenic
1069420834 10:68245046-68245068 GTGCCCCGAACCCAGTCTGCAGG + Intergenic
1070606203 10:77900223-77900245 GTGCCAAGGACCCAGCCTTGTGG - Intronic
1072944436 10:99797045-99797067 TAGCCTCTGACCCAGCCTGGGGG + Intronic
1073062951 10:100743100-100743122 GCGGCCAGGAGCCGGCCTGGCGG + Intronic
1073177500 10:101565406-101565428 TGGCCCCTGACCCAGCCTAGAGG + Intergenic
1075088008 10:119426423-119426445 GGGACTCGGACCCAGGCTGGGGG - Intronic
1077049719 11:561193-561215 GCGCCGCGACCCCAGCCTGGCGG - Exonic
1077145576 11:1042794-1042816 GGGACCCTGAGCCAGCCTGGGGG + Intergenic
1077179799 11:1207215-1207237 TCGCCCAGCACCCACCCTGGAGG + Intergenic
1077233839 11:1470547-1470569 GCCCCTGGCACCCAGCCTGGTGG + Intronic
1077326458 11:1966039-1966061 GGGCCCCGGAGCAGGCCTGGTGG + Intronic
1077342659 11:2032981-2033003 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1083129935 11:60615742-60615764 GCGCCCCTCACCCTGCCTCGCGG - Intergenic
1083419796 11:62546341-62546363 GCGCCCCGTTCCGGGCCTGGTGG - Intronic
1084425890 11:69084477-69084499 ACGCCCCGGCCCCTCCCTGGGGG + Intronic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1084555987 11:69876121-69876143 TGGCTCCGGATCCAGCCTGGGGG + Intergenic
1084594333 11:70107998-70108020 GTGCCACGTACCCTGCCTGGTGG - Intronic
1084642933 11:70436648-70436670 GCGCCCCGGACCTGGGCTGGCGG + Intergenic
1084898621 11:72293647-72293669 TCGGCCTGGACCCAGCTTGGAGG + Intronic
1084945646 11:72636974-72636996 TCCCCCCGGACCCAGCCGGCTGG + Intronic
1087713811 11:101583755-101583777 GCGCCCCAGACGCATCCTCGCGG - Exonic
1089115188 11:116089221-116089243 GTGCTCTGAACCCAGCCTGGAGG - Intergenic
1089750827 11:120649986-120650008 TCCCCCAGGGCCCAGCCTGGTGG + Intronic
1090068562 11:123524936-123524958 ACTCCCAGGCCCCAGCCTGGAGG + Intergenic
1202809439 11_KI270721v1_random:21218-21240 GGGCCCCGGAGCAGGCCTGGTGG + Intergenic
1202825645 11_KI270721v1_random:88170-88192 GCTCCCCGGAGCCTGCCTGCCGG + Intergenic
1095703820 12:45216771-45216793 GCTCCCCGGACCCCGCCCAGGGG - Intronic
1096466441 12:51849358-51849380 GCCCCCTGGCCCCAGTCTGGAGG + Intergenic
1098437278 12:70481360-70481382 ACACCCAGGACCCATCCTGGGGG - Intergenic
1104930415 12:132336589-132336611 GGGCCCGGGACCCCGACTGGAGG + Intergenic
1105000341 12:132686844-132686866 GGGCCGGGGACCCTGCCTGGGGG - Intronic
1105418282 13:20231926-20231948 GCGCCCCGGCCCCGGCCCGATGG - Intronic
1106481440 13:30140170-30140192 ACCCCCAGGACCCAGCCTGGGGG + Intergenic
1107428408 13:40316817-40316839 GCTCCACAGACCCAGCCTGCCGG + Intergenic
1110318256 13:74134498-74134520 GCGCCGCGGACCCAGCCCGGCGG - Intergenic
1112245650 13:97730834-97730856 GCGCCCCTACCCCAGCCTCGAGG - Intergenic
1113517375 13:110914341-110914363 GCGCCTCCGGCCCGGCCTGGAGG + Intronic
1113877474 13:113603313-113603335 GCCCCCTGGACACACCCTGGCGG + Intronic
1115761565 14:36582246-36582268 GCGCTCCGAATCCAGCCAGGCGG + Exonic
1118089411 14:62456630-62456652 GTGCCCCTGACCCAGCCTCAGGG + Intergenic
1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG + Intronic
1121410469 14:93745481-93745503 GGCCCCCAGCCCCAGCCTGGTGG + Intronic
1121642988 14:95498824-95498846 GCCAGCCGGATCCAGCCTGGGGG - Intergenic
1122316409 14:100828166-100828188 GCGCCCCGGCCCGCGCCCGGCGG - Intergenic
1122412308 14:101531868-101531890 GAGACCCTGACCCAGCCAGGGGG - Intergenic
1122719963 14:103716242-103716264 GCGCCCCGCACCCCGCCTCCCGG - Intronic
1122916812 14:104863245-104863267 GAGCCCAGGACCGAGCCGGGGGG - Intergenic
1123627519 15:22238041-22238063 ATTCCCCGGACCCAGCCTGGAGG - Intergenic
1127286585 15:57538692-57538714 CAGCCCTGGGCCCAGCCTGGGGG - Intronic
1128454707 15:67825959-67825981 GCGCCCCGGCCCCAGCTGAGTGG - Exonic
1128551453 15:68600561-68600583 CACCCCCGGACCCAGGCTGGGGG + Intronic
1129236339 15:74225876-74225898 TAGCCCAGGACCCAGGCTGGGGG - Intergenic
1129463762 15:75712630-75712652 GAGACCCCGACCCAGCCTGGCGG - Intronic
1129521904 15:76191524-76191546 GGGCCCCCGTCCCAGCCTGGGGG - Intronic
1129827227 15:78641721-78641743 GGGCCCCTCACCCAGCTTGGGGG + Intronic
1130269851 15:82440472-82440494 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1130462190 15:84167773-84167795 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1130490487 15:84427000-84427022 GGGCCCTGAACTCAGCCTGGAGG + Intergenic
1130502075 15:84505770-84505792 GGGCCCTGAACTCAGCCTGGAGG + Intergenic
1130656375 15:85794600-85794622 GGGCCCCGGCCCCAGCCGCGGGG + Intronic
1131097478 15:89665738-89665760 GCCCCCCGGCCCGGGCCTGGAGG - Exonic
1131118584 15:89809215-89809237 GTGCCCCAGTGCCAGCCTGGGGG - Intronic
1132554881 16:568043-568065 GCCCTCCAGACCCAGCATGGAGG - Exonic
1132824458 16:1896483-1896505 CCGCCACGCACCCAGCCTGGGGG - Intergenic
1132824470 16:1896523-1896545 CCGCCACGCACCCAGCCTGGGGG - Intergenic
1132893170 16:2214486-2214508 GGGGCCCGGCGCCAGCCTGGAGG - Exonic
1132934074 16:2472239-2472261 GCACCCCTGGCCCAGCCTGATGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1133304953 16:4802785-4802807 GAGCCCTGGAACCAGACTGGCGG + Exonic
1137270168 16:46897957-46897979 GCTCCCAGGACCCCGCCTTGTGG - Intronic
1138097068 16:54220154-54220176 GAGTCCCAGACCCAGCCTGGTGG + Intergenic
1139471333 16:67179591-67179613 GCACCCTGGCCCCAGGCTGGTGG - Intronic
1139914490 16:70419661-70419683 GCTTCCCTGTCCCAGCCTGGCGG + Intronic
1140735499 16:77894473-77894495 ACGCCCGGAACCCAGCCAGGAGG + Intronic
1141626422 16:85263978-85264000 CCTCCCCGGCCCCAGGCTGGAGG - Intergenic
1141647044 16:85373179-85373201 GCGCCTGGCACCCACCCTGGTGG - Intergenic
1142066739 16:88067263-88067285 GCGCCCCACACCCAGCCCAGCGG - Intronic
1142279546 16:89140549-89140571 GAGGCCCAGACCCAGCCTGTCGG - Intronic
1143380860 17:6495597-6495619 GACCCCAGAACCCAGCCTGGTGG - Intronic
1143538935 17:7558238-7558260 GCGGGCAGGAGCCAGCCTGGAGG + Intronic
1147446047 17:40475903-40475925 AGGCCCCAGTCCCAGCCTGGGGG - Exonic
1147793036 17:43025174-43025196 CCGCCCCGCCCCCAGCCAGGCGG - Intergenic
1148280516 17:46343369-46343391 GAATCCCAGACCCAGCCTGGGGG - Intronic
1148302744 17:46561304-46561326 GAATCCCAGACCCAGCCTGGGGG - Intronic
1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG + Intronic
1151660727 17:75516680-75516702 GCGCCCGGGACCCGGCCAGGCGG + Intronic
1151662508 17:75526112-75526134 GCCCCCCGCACCCAGCCGGCCGG - Intronic
1152214457 17:79024411-79024433 TCGCCCCGGACCTGGCCGGGAGG + Exonic
1152356377 17:79809681-79809703 GCGGCCTGGAGCCAGCCAGGTGG - Intergenic
1152543333 17:80988166-80988188 GCACCCCTGACCCAGAGTGGAGG + Intergenic
1152627716 17:81395976-81395998 TCGCGCCAGACGCAGCCTGGCGG - Intronic
1152791615 17:82283242-82283264 GCGGCCCTGGCCCAGCCTGCAGG + Intergenic
1152900572 17:82938671-82938693 GAGCCCCGGGCCCACCCTGGAGG - Intronic
1153219155 18:2847145-2847167 GCGCTCCGGACCCGGGCAGGCGG + Exonic
1153684272 18:7529378-7529400 GCCCCTCAGACCCAGGCTGGAGG - Intergenic
1154010816 18:10572378-10572400 GCCTCCCGTACCCAGTCTGGGGG + Intergenic
1155354856 18:24942299-24942321 CCGGCCCCGCCCCAGCCTGGTGG - Intergenic
1156149279 18:34223658-34223680 CAGCCCCGGACGCAGCCCGGGGG - Intronic
1157753086 18:50195204-50195226 GCGCCCCGCCCCCGGCCCGGAGG - Intergenic
1160256019 18:77249741-77249763 GCGCTCCGGTTCCAGCCGGGAGG + Intergenic
1160703785 19:519782-519804 GACCCCTGGACCCGGCCTGGTGG + Intergenic
1160719732 19:591873-591895 GCGTCCTGGACAGAGCCTGGAGG + Intronic
1160754673 19:751184-751206 GCGCCCCGGGCCGGGCCGGGCGG + Intronic
1160771072 19:831495-831517 GGGCACCTGGCCCAGCCTGGAGG + Intronic
1160784395 19:892814-892836 CCGCCCCGAACCCAGCCCCGCGG + Intronic
1161469088 19:4447511-4447533 GCCCCCGGGGCCCAGGCTGGGGG - Intronic
1162088468 19:8262348-8262370 GCCCCCAGGCCACAGCCTGGAGG - Exonic
1162140143 19:8580634-8580656 CCTCCCCAGACCCACCCTGGAGG + Exonic
1162299964 19:9838856-9838878 GGGCAGAGGACCCAGCCTGGGGG + Intronic
1162417498 19:10546931-10546953 GCACCCTGGGCCCAGCGTGGGGG - Exonic
1162857700 19:13481772-13481794 CCTCCCTGGACCCAGCCTGAGGG + Intronic
1163370025 19:16896650-16896672 TCGCCGGGGAACCAGCCTGGGGG + Exonic
1163692232 19:18744165-18744187 ACGCCGCGGCCTCAGCCTGGGGG - Intronic
1165900710 19:39168016-39168038 GAGCACGGGACCCAGTCTGGAGG - Intronic
1165990875 19:39812696-39812718 GGGCCCCCCACCCACCCTGGGGG + Intergenic
1167016130 19:46842282-46842304 GGGCACCTGACCCAGCCTGGGGG - Intronic
1167158391 19:47752805-47752827 GGGCACCTGGCCCAGCCTGGGGG + Intronic
1167885019 19:52493216-52493238 GCGCCCCGGGCCCAGTCCTGGGG + Intronic
1167921464 19:52786344-52786366 GCGCCCCGGCCCCAGCCCCGGGG - Intronic
1168403037 19:56097060-56097082 GAGCCCCGGCCTCAGCCTGCAGG + Intronic
1168691545 19:58380647-58380669 AGGCCCGGGACCCATCCTGGCGG - Intronic
925054417 2:846187-846209 GCACCCTGGAGCAAGCCTGGTGG + Intergenic
925149817 2:1607329-1607351 GCTGCCAGGACACAGCCTGGCGG + Intergenic
926161993 2:10495782-10495804 GTGCCCCGGCCCCATCCTGCAGG + Intergenic
926431501 2:12790921-12790943 AAGCACAGGACCCAGCCTGGAGG - Intergenic
926678230 2:15644594-15644616 GAGCTCCTGGCCCAGCCTGGGGG + Intergenic
929808787 2:45170396-45170418 GCGCACCGGCCTGAGCCTGGAGG + Intergenic
932282860 2:70509710-70509732 GCGCCCGGGAACCAGCCTCCAGG - Intronic
935371950 2:102356364-102356386 CCGCCCCCGCCCCAGCCTCGGGG + Exonic
937265525 2:120612589-120612611 GGTCCCCGAACCCAGGCTGGGGG - Intergenic
943247329 2:185472960-185472982 GCTCCCAGCACCCGGCCTGGTGG + Intergenic
946314000 2:218897654-218897676 GCGGCGCAGACCCGGCCTGGCGG - Intronic
947591722 2:231389734-231389756 GCGCCCCGGACACAGGGCGGCGG - Intergenic
947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG + Intergenic
947621492 2:231593935-231593957 GCGCTCGGTCCCCAGCCTGGTGG + Exonic
948207261 2:236168705-236168727 GCGCCCCCGGCCCAGCCGTGGGG - Intergenic
948821968 2:240554465-240554487 GGGCTCAGGACCTAGCCTGGGGG + Intronic
948903846 2:240968634-240968656 GCGGCCCTGGCCCAGCCTTGGGG + Intronic
948929666 2:241123951-241123973 GCTCACCGGACCCAGCCTGGTGG - Exonic
948933852 2:241149860-241149882 GCGCCCCGGAGCCAGCCAGCTGG + Intronic
949035609 2:241814574-241814596 GCCCCCCGGGCCCACCCTGCTGG + Exonic
1171268984 20:23798824-23798846 ACTCCCTGGATCCAGCCTGGAGG + Intergenic
1171346373 20:24469396-24469418 GCGCCCCTCGCCCAGCCTGCCGG + Exonic
1172872639 20:38145189-38145211 GCTGCCCTGACCCAGCCTGCTGG + Intronic
1173221689 20:41137248-41137270 CGGCCCCGGACACAGCCCGGCGG - Intronic
1173918269 20:46725653-46725675 CCTCCCCGGGCCCAGCTTGGGGG - Exonic
1175760711 20:61560768-61560790 GAGCCCGGGTCTCAGCCTGGGGG + Intronic
1175931650 20:62496475-62496497 GAGCCCCGGACCCTGCTGGGTGG + Intergenic
1176132693 20:63502958-63502980 GAGCCCAGCACCCACCCTGGTGG + Intergenic
1176311655 21:5154026-5154048 GGGCCGCGGAGCCGGCCTGGGGG - Intronic
1176383871 21:6127401-6127423 GGTCCCTGGGCCCAGCCTGGAGG + Intergenic
1179585231 21:42370318-42370340 ACCCCCCTGCCCCAGCCTGGGGG + Intergenic
1179739602 21:43410837-43410859 GGTCCCTGGGCCCAGCCTGGAGG - Intergenic
1179907962 21:44433968-44433990 CCGTCCCTGACCCTGCCTGGCGG - Intronic
1180041447 21:45282313-45282335 GCCCCCCGGGAGCAGCCTGGAGG - Intronic
1181381498 22:22508378-22508400 GAGGCCCGGGCCCAGCCCGGGGG + Intronic
1181956191 22:26589644-26589666 GCGCCCTGGCGCCCGCCTGGGGG + Intronic
1182137346 22:27918838-27918860 TGGGCCCAGACCCAGCCTGGGGG + Intronic
1183432699 22:37775175-37775197 GAGACCCTGACCCAGCCTGCAGG + Exonic
1183504693 22:38202506-38202528 GCGCCCCCGCCCCCGCCGGGCGG - Intronic
1184837470 22:47032405-47032427 AGGCCCTGGACCCAGTCTGGGGG - Intronic
1184972690 22:48037797-48037819 CCTCCCAGGAACCAGCCTGGAGG + Intergenic
1185107494 22:48882693-48882715 GCACTGCAGACCCAGCCTGGGGG + Intergenic
950360676 3:12447428-12447450 GAGCCCCTAACTCAGCCTGGAGG + Intergenic
950912140 3:16605508-16605530 GCGCCCCGCCCCCTGCGTGGGGG + Intronic
952419010 3:33114583-33114605 CCGCCCCTGACCCAGCCTCCAGG + Intronic
953971650 3:47352963-47352985 GTGCCCCCGACCCAGGATGGAGG + Intergenic
954382567 3:50227427-50227449 GCGCCCCAGCCCCCGCCTCGCGG - Intronic
955187728 3:56731249-56731271 GGCCCCCGGGCCCAGCCTGGAGG - Intronic
959431157 3:106256577-106256599 GCGTCCCAGCCCCAGCATGGAGG - Intergenic
960586075 3:119322744-119322766 GCGGCCGGGCCCCAGCCTAGAGG - Intronic
962609883 3:137066267-137066289 GCACCCATGAGCCAGCCTGGAGG - Intergenic
963133289 3:141877158-141877180 GCGCCCCGCTCCCAGCAGGGAGG - Intronic
963259168 3:143176353-143176375 CCCCCCCGGGCCCCGCCTGGAGG - Intergenic
965590425 3:170356963-170356985 CCGCCCCGGAGGCAGCCGGGCGG - Intergenic
966901809 3:184492187-184492209 GCGCCCCGGACTGAACCTGGGGG - Intronic
967143196 3:186581444-186581466 GCGCCCAGGGCCCAGCTGGGTGG - Exonic
968130958 3:196192565-196192587 GGGCCCCGCCTCCAGCCTGGTGG + Intergenic
968891207 4:3369431-3369453 GAGCCATGGACCTAGCCTGGTGG + Intronic
968902813 4:3439277-3439299 GCGTACCTGCCCCAGCCTGGAGG + Intronic
968913817 4:3488523-3488545 GCGGACAGAACCCAGCCTGGCGG - Intronic
973888426 4:55346237-55346259 GCGCACCGGTCTCAGCCTAGCGG - Exonic
979335304 4:119455156-119455178 GGTCCCCGGGCCCTGCCTGGGGG - Intergenic
985644628 5:1079101-1079123 GCCCCGCGGGCCCAGCCTGCCGG + Intronic
986004237 5:3654740-3654762 TGGCCCCCGACCCAGCCTGAAGG + Intergenic
986447229 5:7832096-7832118 GCTCCCAGGACCCAGGCTGATGG - Intronic
986737032 5:10675482-10675504 GAGCCCGGGACCCAGCCCAGGGG - Intergenic
988993130 5:36690478-36690500 GCTCCCCGGACGCCGCCTCGCGG - Intergenic
990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG + Intronic
992143723 5:73824412-73824434 GGTCCCCTGACCCAGCCAGGAGG - Intronic
998153209 5:139769082-139769104 GGGCCTGTGACCCAGCCTGGTGG + Intergenic
999828737 5:155299102-155299124 GCACCCAGGACCCAGCTAGGGGG + Intergenic
1001400007 5:171440805-171440827 GGGCTCTGTACCCAGCCTGGGGG - Intronic
1002280051 5:178124561-178124583 GCTGCCCGGACCAAGCCTGTTGG - Exonic
1003097979 6:3157265-3157287 GCCTCCCGGACCCCGCCCGGCGG + Intronic
1006187578 6:32189866-32189888 CCCCCCCGGCCCCCGCCTGGAGG + Exonic
1006414986 6:33898207-33898229 GGGCCCCTGACCAGGCCTGGTGG - Intergenic
1007630675 6:43271598-43271620 GGGCCCTGGCCCCTGCCTGGGGG + Intronic
1007633502 6:43285242-43285264 CCGGCCCGGGCCCAGCCTGATGG + Exonic
1007759835 6:44127428-44127450 GCGCGCCAGGCCCAGCCCGGCGG + Exonic
1009176048 6:60460930-60460952 GCGCCCCTCCCCCAGCCTTGCGG + Intergenic
1013099201 6:106973836-106973858 GCGACCCGAACAAAGCCTGGCGG + Exonic
1013233281 6:108175644-108175666 GCGCCCCAGGCCCAGGCAGGGGG + Intronic
1013576109 6:111484111-111484133 GTGCCCGGGACGCAGCCTGCGGG - Intergenic
1014272270 6:119348789-119348811 GCGCCCCGGGCCCGGGCTTGTGG + Exonic
1015910179 6:138161862-138161884 GCGCACCTGACCCAGGCGGGCGG + Intergenic
1017149614 6:151266972-151266994 GCGCCACTGCACCAGCCTGGCGG + Intronic
1019542706 7:1558768-1558790 GGGCCCCGGACACAGACTGAGGG + Intronic
1025191467 7:56898868-56898890 GTGCCCCCAACCCAGCCAGGAGG + Intergenic
1025680481 7:63678066-63678088 GTGCCCCCAACCCAGCCAGGAGG - Intergenic
1026202640 7:68227840-68227862 TGGCCTGGGACCCAGCCTGGTGG - Intergenic
1029542532 7:101192581-101192603 GCACCTTGGACCCAGCCTGTAGG + Intergenic
1032284843 7:130532259-130532281 ACGCCTCGGTCCCAGACTGGAGG + Intronic
1033536974 7:142321204-142321226 GAGCACCGGAGACAGCCTGGTGG - Intergenic
1034306220 7:150047456-150047478 GCGCCACGGAGCCTGTCTGGGGG + Intergenic
1034425133 7:151010123-151010145 GGGTCCCGCACCCAGCCGGGGGG - Exonic
1034430101 7:151036830-151036852 GCGCCACTGCCCCAGCCAGGAGG - Intronic
1034800624 7:154053196-154053218 GCGCCACGGAGCCTGTCTGGGGG - Intronic
1035479406 7:159169930-159169952 GGGCCCCGGACCTCGCCTGAGGG + Intergenic
1035765136 8:2099372-2099394 GAGCCCCGGCCCCAGCTGGGAGG + Intronic
1036205269 8:6800925-6800947 GAGCCCAGGTTCCAGCCTGGGGG + Intergenic
1036454322 8:8893761-8893783 GCGCCCCGGACCATGCTGGGCGG + Intergenic
1036708073 8:11059731-11059753 GCCCCCCGGACCCCGCCCCGCGG + Intronic
1037837166 8:22221155-22221177 GTGGCCCACACCCAGCCTGGTGG - Exonic
1037879372 8:22565621-22565643 GCCCCCGGGCCCCAGCCTCGGGG + Intronic
1041244856 8:55880174-55880196 GCGCCCGGGACTCCGGCTGGTGG - Intronic
1041726595 8:61023721-61023743 GCGCGCCGGCCCCAGGGTGGGGG + Intergenic
1042872686 8:73412565-73412587 GGGCACTGGAGCCAGCCTGGGGG + Intergenic
1045638719 8:104223492-104223514 GCCTCCCTGACCCAGCCCGGAGG - Intronic
1046547299 8:115668456-115668478 GCGCCCCGGGCCCGGCCGAGGGG + Intronic
1049194463 8:141307966-141307988 GCGGCGCGGACCCGACCTGGAGG + Intronic
1049463973 8:142742752-142742774 GCCACCCAGCCCCAGCCTGGGGG + Intergenic
1049540695 8:143207541-143207563 GCACTCCAGAGCCAGCCTGGGGG - Intergenic
1049658402 8:143808931-143808953 GCCCCCTGGACCCTGCCAGGCGG - Exonic
1049843236 8:144787368-144787390 GCGCCTCGGACCCAGACAGTCGG - Intergenic
1051170451 9:14315001-14315023 GCGCCCCAGCCCCGGCCTGGGGG - Intronic
1053079406 9:35162052-35162074 GCGCCCAGTCCCCAGCCTGCCGG + Exonic
1056475198 9:86946401-86946423 GCGCCGCGGGCCCGCCCTGGAGG - Exonic
1057726602 9:97572578-97572600 GTGCCCCAGCCCCAGGCTGGGGG + Intronic
1057869406 9:98707480-98707502 GCGCTCCAGCCCCGGCCTGGCGG + Intronic
1059816625 9:117923740-117923762 GAGCCACGCACCCAGCCTTGTGG + Intergenic
1060727740 9:126017095-126017117 GCCGCCAGGCCCCAGCCTGGTGG + Intergenic
1062325907 9:136012388-136012410 CCGTCCCAGTCCCAGCCTGGAGG + Intronic
1062332132 9:136049505-136049527 GAGCCCCCCACCAAGCCTGGAGG - Intronic
1062526306 9:136979319-136979341 GCCCCCTGGGCCCAGCCTGGGGG + Intronic
1062721585 9:138047059-138047081 GCTCCCCCGCCACAGCCTGGCGG - Intronic
1185750705 X:2608452-2608474 GGGCCCCTGACGCAGCCTGCTGG + Intergenic
1189236974 X:39494775-39494797 GTGCCCAGGCCCCAGTCTGGAGG + Intergenic
1190464012 X:50707929-50707951 GGGCCCTGGACCCACCCTGCAGG + Intronic
1193268921 X:79506761-79506783 GCGCCCCAGCCCTGGCCTGGAGG - Intergenic
1194066823 X:89271348-89271370 GCGACCCAGCCCCAGCCTGGAGG + Intergenic
1199274209 X:145922979-145923001 GGTCCCCTGACCCAGCATGGAGG + Intergenic
1199977431 X:152902651-152902673 CCCCCCAGCACCCAGCCTGGCGG + Intergenic
1201299004 Y:12490051-12490073 CCGCCCCGGGCCCAGACTGGAGG + Intergenic
1202367743 Y:24178553-24178575 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1202377091 Y:24247359-24247381 GGGCCCTGAACTCAGCCTGGAGG + Intergenic
1202493689 Y:25422762-25422784 GGGCCCTGAACTCAGCCTGGAGG - Intergenic
1202503040 Y:25491570-25491592 GGGCCCTGAACTCAGCCTGGAGG + Intergenic