ID: 990546987

View in Genome Browser
Species Human (GRCh38)
Location 5:56832562-56832584
Sequence GTGGTAGCACAGCTAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990546978_990546987 30 Left 990546978 5:56832509-56832531 CCATTTTACATATGAGAAATCAG 0: 1
1: 8
2: 168
3: 1436
4: 5935
Right 990546987 5:56832562-56832584 GTGGTAGCACAGCTAGTGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990546987 Original CRISPR GTGGTAGCACAGCTAGTGGG TGG Intronic
902079799 1:13813234-13813256 GAGGTCACACAGCTAGTGGGTGG + Intronic
902811911 1:18892730-18892752 AAGGTCACACAGCTAGTGGGAGG - Intronic
903424581 1:23244424-23244446 GTGGAGTCACAGCAAGTGGGAGG + Intergenic
904263761 1:29306053-29306075 CAGGTTGCACAGCTAGTGAGTGG + Intronic
905279869 1:36842185-36842207 GTGGTTACAGAGCTAGTGAGCGG + Intronic
908442369 1:64168211-64168233 GTGGTCTCACAGCTGGTAGGTGG - Intronic
914336993 1:146724557-146724579 GTGGCAGCACAGCTCATTGGTGG + Intergenic
914731172 1:150371695-150371717 GTGGTTACACAGCTAATAGGTGG + Intronic
918016070 1:180633124-180633146 GTGTTAGCACAGAAATTGGGAGG - Intronic
920249262 1:204612083-204612105 AAGGTTGCACAGCTAGTAGGAGG - Intergenic
920790547 1:209086014-209086036 GTGGTAGAATAGCTAGGTGGTGG - Intergenic
921022951 1:211253187-211253209 GTGGTAGCAAGGCTAGAGGCAGG - Intergenic
922476915 1:225912618-225912640 TTGGGAGCACAGCCAGTGAGGGG - Intronic
922544408 1:226445130-226445152 GTGGCAACACAGGTTGTGGGAGG + Intergenic
1063711044 10:8478985-8479007 GTAGTTGCTCAGCTAGTGGCAGG + Intergenic
1064274714 10:13894895-13894917 AAGCTTGCACAGCTAGTGGGTGG - Intronic
1066179316 10:32944287-32944309 CTGGCAGCGCTGCTAGTGGGCGG - Intronic
1066579244 10:36861971-36861993 GTGGTAGTGAAGCCAGTGGGTGG + Intergenic
1067302973 10:45031342-45031364 GTGGGGGCACAGCTGGGGGGTGG - Intergenic
1068865067 10:61886381-61886403 GTAGTAGCACAGTTGGAGGGAGG - Intergenic
1072419360 10:95276750-95276772 GAGGTTGCACAGCTGGTGAGCGG + Intronic
1072450746 10:95537741-95537763 GCGGTCACACAGCTAGTGAGTGG + Intronic
1072822886 10:98575672-98575694 GTGGTCACACAGCTAGCTGGGGG + Intronic
1074120056 10:110487479-110487501 GCGGAAGCACAGGAAGTGGGAGG - Intergenic
1075645938 10:124096192-124096214 AGGGTTGCTCAGCTAGTGGGTGG - Intergenic
1076024383 10:127100233-127100255 GTGGCAGCAAAGCCAATGGGAGG + Intronic
1077367277 11:2166288-2166310 GTGGCAGCACAGGCCGTGGGAGG + Intronic
1079982725 11:27168367-27168389 GTGGGAGCAGAGGTAGTGGTGGG - Intergenic
1080942567 11:36936311-36936333 TTGGGAGCCCAGCCAGTGGGAGG + Intergenic
1082758226 11:57099480-57099502 ATGATAACACAGCTAGTGGATGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084482444 11:69429822-69429844 GTGGGAGCTCAGCGTGTGGGTGG + Intergenic
1085491462 11:76922651-76922673 GTGCTAGCACATCTAGTGAGAGG + Intronic
1089194515 11:116686315-116686337 AAGGTCACACAGCTAGTGGGTGG - Intergenic
1090619423 11:128548433-128548455 AGGGTTGCACAGCTGGTGGGTGG + Intronic
1094550356 12:31445313-31445335 GTGGTTGCATAGCTAGTGATTGG - Intronic
1095225437 12:39672343-39672365 GTGGCAGCAGAGGCAGTGGGTGG + Intronic
1095970139 12:47896046-47896068 CTTGTTGCACAGCTAGTGGTAGG - Intronic
1096877331 12:54640212-54640234 ATGATAACACAGCTAGTGAGTGG + Intergenic
1099174699 12:79407447-79407469 GTGGTAGCAACTCTAGAGGGTGG - Intronic
1102386458 12:112514573-112514595 GTGGTAGCAGAGCTAGGGAGAGG - Intergenic
1106656791 13:31755138-31755160 GAGGTCACACAGCTAGTGAGTGG + Intronic
1108738143 13:53306913-53306935 GAGGTCACACAGCTAGTGCGGGG + Intergenic
1110687019 13:78387604-78387626 TTGTTAGCTCAGCTTGTGGGAGG + Intergenic
1111711145 13:91815905-91815927 GGGGTAGCAGAGGAAGTGGGAGG - Intronic
1113339614 13:109409347-109409369 CTGGCAGCACAGCCACTGGGTGG - Intergenic
1118296876 14:64578089-64578111 GTGGTAGCAGAGTTTGTGGTGGG - Intronic
1119275002 14:73347224-73347246 GTAGTAGCAAAGATAGTGTGAGG - Intronic
1123031005 14:105451041-105451063 GTGGCAGCAGAGCCCGTGGGAGG - Intronic
1124857502 15:33404963-33404985 GAGGTCACACAGCTAGTTGGTGG - Intronic
1127803189 15:62495043-62495065 AGGGTAGCACAGCTAGGAGGTGG - Intronic
1128385920 15:67148277-67148299 TCGGTAGCACAGCCAGAGGGAGG + Intronic
1130060905 15:80569305-80569327 GTTGTAGCCCAGCTAATGGAGGG + Intronic
1131295306 15:91143034-91143056 GTGACAGCACAGCCAGTGGCTGG + Intronic
1132806457 16:1777316-1777338 GTGGCAGCACAGGTACTGGAGGG + Exonic
1132815443 16:1824016-1824038 GTGGCAGCACAGCTTGCTGGAGG - Intronic
1135071592 16:19356916-19356938 ATGGTTACACAGCTAGTGAGTGG + Intergenic
1135200037 16:20429518-20429540 ATGGTTGCAAAGCCAGTGGGTGG + Intronic
1135218661 16:20594090-20594112 ATGGTTGCAAAGCCAGTGGGTGG - Intergenic
1135707001 16:24683674-24683696 AAGGTTGCACAGCTAGTCGGTGG - Intergenic
1136060628 16:27723863-27723885 GTGGATGGACAGCTGGTGGGTGG - Intronic
1137444864 16:48525566-48525588 GTGAGAGCACAGCCTGTGGGAGG - Intergenic
1139997276 16:70992762-70992784 GTGGCAGCACAGCTCATTGGTGG - Intronic
1140041285 16:71410002-71410024 GTGGTGACACAGCCAGTGAGTGG + Intergenic
1143137137 17:4718250-4718272 ATGGTAGTACAGCTTTTGGGGGG - Exonic
1143156544 17:4840914-4840936 TTGGTGGCACAGCCTGTGGGAGG + Intronic
1143401126 17:6643643-6643665 GTGGTTACACAGCTAGTAAGTGG - Exonic
1144375831 17:14640154-14640176 GTGGAAGCACAGTTAGAGGCAGG + Intergenic
1147374605 17:40016237-40016259 GGGGTGGCACAGCTTGTAGGTGG - Exonic
1148159223 17:45440706-45440728 GAGGTCACACAGCTAGTAGGTGG + Intronic
1148618252 17:49015635-49015657 GTGGAAGCACAGAGAATGGGGGG - Intronic
1149687941 17:58549010-58549032 GTAGTAGCACATCCAGTTGGGGG + Intergenic
1150292543 17:63989864-63989886 GTGGGAGCACAGCTTTTGTGTGG - Intergenic
1150485503 17:65540607-65540629 GTGGAAGTGCACCTAGTGGGAGG + Intronic
1151363661 17:73603756-73603778 GGGGTCACACAGCTTGTGGGTGG + Intronic
1151388516 17:73770308-73770330 GGAGTCACACAGCTAGTGGGTGG + Intergenic
1151661747 17:75522603-75522625 TTGGGATCACAGCTAGTTGGTGG - Intronic
1152072015 17:78138678-78138700 GTGGGAGCCCAGGTAGTGGAGGG - Exonic
1157302349 18:46488156-46488178 GTGGGAGCATAGGGAGTGGGAGG + Intronic
1158932260 18:62333610-62333632 GAGTTTGCACAGCTAGTGAGTGG + Intronic
1162906071 19:13824926-13824948 AGGGTCACACAGCTAGTGGGTGG + Intronic
1165850654 19:38848694-38848716 TAGGTGGCACAGCTAGTGAGGGG - Intronic
1167805291 19:51779013-51779035 GTGGTAACACAGCCATTGGGAGG + Intronic
1168454275 19:56493880-56493902 GTGGTGGCACAGCTACTTGGTGG - Intergenic
926114412 2:10203326-10203348 GAGGTCACACAGCTAGTGGGTGG - Intronic
932314431 2:70770085-70770107 TAGGTCACACAGCTAGTGGGTGG + Intergenic
934041627 2:88131711-88131733 GTGTTTGCTCAGCTAGTGGGTGG - Intergenic
943672860 2:190682369-190682391 GTGGTCACATAGCTAGTGAGTGG + Intronic
945501757 2:210584253-210584275 GTGGCATCACAGCTATTGGCTGG + Intronic
946059182 2:216927173-216927195 AAGGTTACACAGCTAGTGGGGGG + Intergenic
947099040 2:226599275-226599297 GTGGAAGCTCAGCTAGACGGTGG + Intergenic
948183637 2:236002131-236002153 TTGGTAGCACTGCTTGTGCGGGG - Intronic
948903828 2:240968555-240968577 CTGGGGGCACAGCGAGTGGGGGG + Intronic
1170544105 20:17418706-17418728 GTGTCTGCACAGCTGGTGGGAGG - Intronic
1171137747 20:22712252-22712274 GTGGTCACACAGCTTGTAGGAGG + Intergenic
1171331265 20:24340630-24340652 GTGGAAGCTCAGCAAGTGTGAGG + Intergenic
1171983208 20:31641548-31641570 GTGGTTGCACAGCTAGAGAGTGG + Intronic
1172119929 20:32592296-32592318 GAGGTCGCACAGCTAGTGGTGGG + Intronic
1174042732 20:47711303-47711325 GTGGTCCCACAGCTAGGAGGTGG - Intronic
1174389313 20:50208092-50208114 GAGGTCACACAGCTGGTGGGTGG + Intergenic
1176171559 20:63698691-63698713 GTAGTTGCACAGCTACTGGGAGG + Exonic
1179012264 21:37564867-37564889 GGGGAAGCACAGCTGGTAGGTGG + Intergenic
1179976788 21:44873079-44873101 GAGGTCGCACAGCTGGTCGGGGG - Intronic
1180737834 22:18031848-18031870 CTGGTAGCAGAGCTGGAGGGTGG - Intergenic
1182290335 22:29272814-29272836 GTGGTTGCACAGTAAGTGGCGGG + Intronic
1182487482 22:30648032-30648054 ATGGTAGCCCAGCCAGTGGAGGG - Intronic
1183903165 22:41021531-41021553 GAGGTCGCACAGATGGTGGGTGG + Intergenic
1185165749 22:49261267-49261289 GTGGAAGCCCAGCTAGGAGGCGG + Intergenic
1185285946 22:49999944-49999966 GGGGAAGCTCAGCTACTGGGTGG - Exonic
949887014 3:8703628-8703650 AAGGTGTCACAGCTAGTGGGGGG + Intronic
950278049 3:11680777-11680799 GTGGTCTCACAGCAAGTCGGTGG - Intronic
950621324 3:14207821-14207843 GTGGTAACACACCTGGTGGCAGG + Intergenic
950674573 3:14546843-14546865 GTCACAGCACAGCTGGTGGGGGG + Intergenic
950678668 3:14569840-14569862 GTGGTCCCACAGCTAGTTTGTGG + Intergenic
952314547 3:32221234-32221256 GAGGTTGCACAGCTGGTGGATGG - Intergenic
954922121 3:54200227-54200249 CTGGTTACACAGCTAGTGGGTGG + Intronic
957682960 3:83461537-83461559 GTAGTAGCACAGCTGTTTGGGGG - Intergenic
959709687 3:109372827-109372849 GTTGTAGCACAGCCAGAGGTAGG + Intergenic
959812777 3:110638228-110638250 GAGGTAGCACAGCTATTAAGTGG - Intergenic
959931611 3:111989489-111989511 CAGGTAGCAGAGCTAGTTGGGGG + Intronic
960591708 3:119372827-119372849 GGGGTGGTACAGCTAGTAGGTGG + Intronic
961149124 3:124621442-124621464 GTGGTGGCATAGTAAGTGGGAGG + Intronic
961903743 3:130241010-130241032 GTGGTCACACAGCTAGTTAGAGG + Intergenic
965665311 3:171087509-171087531 GAGGGAGCACAGCACGTGGGAGG + Intronic
967402430 3:189078752-189078774 AAGGTAGCACAGCTAGTGTGTGG - Intronic
968226724 3:196977090-196977112 GGGGTTACACATCTAGTGGGTGG - Intergenic
971036501 4:22699046-22699068 GTGGTTACATAGCTAGCGGGTGG + Intergenic
971254763 4:25004193-25004215 GTGGTAGCCCAGCTCTTCGGTGG - Exonic
973608976 4:52615984-52616006 CTGGTAGAAAAGCTAGTAGGGGG + Intronic
978489939 4:109302120-109302142 GTGGCTGCACAACTAGTTGGTGG + Intronic
979831834 4:125314743-125314765 GTGGGAGCACAGCGAGGCGGAGG - Intergenic
981648661 4:147029682-147029704 GTGATTGCACAGATGGTGGGAGG - Intergenic
983182726 4:164667793-164667815 GTGGTAGCAAAGCTGGAGGAGGG + Intergenic
984591915 4:181626548-181626570 GTGAGAGCACAGCAAGGGGGCGG + Intergenic
985625365 5:982694-982716 GTGGTCGCAGAGGTAGAGGGAGG + Intergenic
990546987 5:56832562-56832584 GTGGTAGCACAGCTAGTGGGTGG + Intronic
992558889 5:77930498-77930520 GTGGTAGCAAAGCTGGGGTGTGG - Intergenic
997293388 5:132753801-132753823 GTGGTAGCACAGCATGAGAGAGG - Exonic
999546388 5:152633143-152633165 GGGGTAGCACAGCCATTAGGAGG + Intergenic
999640153 5:153664345-153664367 GAGGTTGCACAGCTAGGAGGTGG + Intronic
999812161 5:155138003-155138025 GTGGGAGCACAGCAAGGGAGAGG + Intergenic
1001582342 5:172807380-172807402 GTGGTGACGCAGCTAATGGGAGG - Intergenic
1003302027 6:4892585-4892607 GTGGTAGCACAGTCTGTGGATGG - Intronic
1005790735 6:29297005-29297027 ATGGTGGAACAGCCAGTGGGTGG - Intergenic
1006442592 6:34061553-34061575 GGGGTCACACAGCTAGTAGGTGG + Intronic
1006453246 6:34117496-34117518 GTGGCAGCTGAGGTAGTGGGTGG - Intronic
1006520734 6:34569560-34569582 GAGGTAACACAGCTTGTGAGTGG + Intergenic
1006739423 6:36296776-36296798 GAGGTCACACAGCTTGTGGGTGG - Intronic
1007314799 6:40978830-40978852 GTGGCAGCACAGCTTGGGGTGGG + Intergenic
1007788499 6:44295784-44295806 AAGGTTGCACAGATAGTGGGGGG - Intronic
1008960567 6:57261682-57261704 GTGGGGGCACAGCCAATGGGTGG + Intergenic
1011160410 6:84383088-84383110 GTGATGGCACAGTTAGAGGGAGG - Intergenic
1016887297 6:148970278-148970300 GTGGTAGCACAGGTGGCAGGGGG - Intronic
1020281720 7:6653371-6653393 GTGGAAGCCCAGCGGGTGGGAGG - Exonic
1023913707 7:44573019-44573041 GTGGTAGAACAGGCAGTGAGAGG - Exonic
1024262013 7:47580508-47580530 GTGGTAGCACAGGGGGTGGGGGG - Intronic
1024301606 7:47891225-47891247 CCTGTAGCACAGCTAGTGAGGGG + Intronic
1026649219 7:72200278-72200300 ATCGTTGCACAGCTAGTAGGTGG - Intronic
1027146588 7:75699816-75699838 GTGGCTGCACAGCTTGTGGTTGG - Intronic
1030295042 7:107916182-107916204 CTTGTCACACAGCTAGTGGGTGG + Intronic
1031657422 7:124375006-124375028 GTGTTCACACAGCTAGTGTGTGG + Intergenic
1037062437 8:14531437-14531459 CTGGTAGCTCAGCAAGCGGGAGG - Intronic
1037367123 8:18135002-18135024 GTGGGAGGAGAGCAAGTGGGAGG + Intergenic
1038590455 8:28832600-28832622 AAGGTCGCACAGCTAGTGAGTGG - Intronic
1041880646 8:62745917-62745939 ATGGTAGCATAGCTAGTTAGTGG - Intronic
1046799725 8:118412682-118412704 GTGGTACCTCAGCTGGTAGGTGG - Intronic
1048178947 8:132177859-132177881 CTGGTAGCACAGCTTTCGGGAGG + Intronic
1053274976 9:36776434-36776456 ATGGTCACACAGCTAGTGAGTGG + Intergenic
1054809662 9:69425047-69425069 GTGGGAAGACAGCTGGTGGGAGG - Intergenic
1057305148 9:93907929-93907951 GAGGTTGCACAGCTGGTGAGTGG - Intergenic
1057784991 9:98080701-98080723 CTGGCTGCACAGCTAGTGAGTGG + Intronic
1058506757 9:105674237-105674259 GTGGCAGAACAGCAGGTGGGAGG - Intergenic
1059172169 9:112135923-112135945 GTGGTTGCACAACTAGTTAGTGG + Intronic
1059311340 9:113390763-113390785 GTGGCAGCAGGGCTGGTGGGAGG + Intronic
1059346289 9:113631247-113631269 TTGGTCACACAGCTAGTAGGTGG + Intergenic
1060377948 9:123135117-123135139 GTGGTAACACAGCTAATTGATGG - Intronic
1062034005 9:134374662-134374684 GGGGAGGCACAGCAAGTGGGTGG + Intronic
1062720816 9:138043134-138043156 GTGGGAGCACAGCTGGGGTGTGG + Intronic
1190559665 X:51674356-51674378 GTGGTCACACAGCTAGTAAGTGG + Intergenic
1190564626 X:51718965-51718987 GTGGTCACACAGCTAGTAAGTGG - Intergenic
1192221149 X:69198073-69198095 GAGGTTGCACAGCTAGTTGGTGG + Intergenic
1192927924 X:75776198-75776220 GTGGTGGCACAGTATGTGGGAGG + Intergenic
1193521509 X:82535629-82535651 GAGGTCACACAGCTAGTGGTTGG + Intergenic
1194663943 X:96656362-96656384 GTGGCAACACAGCTGGTGAGGGG - Intergenic
1195960872 X:110385128-110385150 GAGGTCTCACAGCTAGTTGGTGG - Intronic
1196701702 X:118676916-118676938 ATGGTCACACAGCTAGTGAGTGG - Intronic
1198590895 X:138179984-138180006 TTGGTTATACAGCTAGTGGGTGG + Intergenic
1200303740 X:155004822-155004844 GTGGTAGGACAGCTTGTTGAAGG + Intronic
1201749405 Y:17416236-17416258 CTTTTAGCACATCTAGTGGGTGG - Intergenic