ID: 990547412

View in Genome Browser
Species Human (GRCh38)
Location 5:56836752-56836774
Sequence GTCCCCTAAAAGAAGTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990547412_990547416 -4 Left 990547412 5:56836752-56836774 CCAGCATACTTCTTTTAGGGGAC 0: 1
1: 0
2: 1
3: 9
4: 109
Right 990547416 5:56836771-56836793 GGACTGAAGGAAAGGGACCCAGG 0: 1
1: 0
2: 0
3: 22
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990547412 Original CRISPR GTCCCCTAAAAGAAGTATGC TGG (reversed) Intronic
905119481 1:35670813-35670835 GTCCCCTAAAAAAAATATGCTGG + Intergenic
905377687 1:37534966-37534988 GTCCACTTTAAGAAGTCTGCTGG + Exonic
908063528 1:60377403-60377425 TTCCCCTAAAAGTATTATTCAGG + Intergenic
908251789 1:62271651-62271673 GTCCCCTCAAAGCAATATCCTGG - Intronic
914751356 1:150537277-150537299 GCCCTCAAACAGAAGTATGCAGG - Intergenic
915404783 1:155651442-155651464 TTTTCCTAAAAGAAGAATGCTGG - Intergenic
915459680 1:156062413-156062435 CTGCCCTAAAGGAAGTATGAAGG - Intronic
916287545 1:163126954-163126976 GTCCCATAAAAGAAATATTAGGG + Intronic
916295271 1:163212303-163212325 GTCCCCCAAAACATGTAGGCTGG + Intronic
918037141 1:180884801-180884823 GTCTCCTGAAAGAGGTATGTGGG - Exonic
921129989 1:212211418-212211440 GTCCCCTAAAAAGCGTATGCTGG + Intergenic
921890028 1:220344529-220344551 GTCCCATAAAAGCATTATGGAGG + Intergenic
922491421 1:226020040-226020062 GTCAACTAAAACAAGGATGCAGG + Intergenic
924356024 1:243176812-243176834 GTCACCTGAAAGAACCATGCAGG + Intronic
1067083167 10:43223275-43223297 GTCCCCAAATAGAAGTGTGCAGG + Intronic
1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG + Intronic
1075192454 10:120322556-120322578 GTTCTCAAAAAGAAGTAAGCAGG - Intergenic
1076135481 10:128042653-128042675 GACCCCTGGAAGAAGTATGAAGG + Intronic
1080388723 11:31825652-31825674 GTCCCCGAAATGAATAATGCAGG - Intronic
1080840887 11:35982507-35982529 GTCCCCCAAAAACAGTATGCCGG - Intronic
1082061856 11:47867728-47867750 GTCCCCACAAAGAAGAATGGGGG - Intergenic
1082981598 11:59128940-59128962 GTCTCCTAAGAGAAGTAACCAGG + Intergenic
1086013342 11:82133028-82133050 GTCTCATAACAGGAGTATGCTGG + Intergenic
1094042267 12:26130696-26130718 GTCACATAAAAGAAGTCTGAAGG + Intronic
1095493241 12:42758231-42758253 GTCCCCTAAAATAACTATCAGGG + Intergenic
1101044818 12:100794301-100794323 GTCCCCTAAATGATGTCTGATGG - Intronic
1103780256 12:123393923-123393945 GTCCCCAAAAAAATCTATGCAGG - Intronic
1113538810 13:111090378-111090400 GTCCCCTGAAAGCTGTATCCAGG - Intergenic
1115613242 14:35069024-35069046 GTCCCCTAAAAAACGTGTGTTGG - Intronic
1119963638 14:78888256-78888278 GTCCCCTAAAGGAGGTTTTCTGG + Intronic
1120119302 14:80658474-80658496 GTCTCTTAAAAGAAGGAAGCTGG - Intronic
1120792002 14:88592799-88592821 GTCTCTTAAAAGAAGAATCCTGG - Intronic
1121174281 14:91879168-91879190 GTTTCCTAAAAGAAGTTTGGAGG + Intronic
1122937027 14:104964490-104964512 GTCCCTCAAAAGATGGATGCAGG + Intronic
1123627354 15:22236953-22236975 GTCCCCAAAGAGAGGGATGCCGG + Intergenic
1123876870 15:24632211-24632233 GTCTCCTCAAAGAAGGATGCAGG - Intergenic
1125969338 15:43899388-43899410 CTCCCCCAAAAGAAGTCTCCTGG + Intronic
1133692273 16:8228288-8228310 GGCACCAAAAATAAGTATGCTGG - Intergenic
1141862764 16:86729253-86729275 GTCCCCTATGAGAGGGATGCAGG - Intergenic
1141976600 16:87520425-87520447 GTCCCCAAAGAGAGGGATGCCGG - Intergenic
1144142590 17:12363884-12363906 TTCCCCTCAAAGAAGTATTCTGG - Intergenic
1146489327 17:33269100-33269122 GTGCCCTAAAAGAACTATCCTGG + Intronic
1148031032 17:44621220-44621242 GACCCCCAAAAGAAGTTTCCCGG + Intergenic
1152269410 17:79315302-79315324 GTCCCCAGAGAGAAGGATGCAGG - Intronic
1155502091 18:26497046-26497068 GTCCCCAAAAAGTACTATGATGG - Intronic
1156675375 18:39521739-39521761 CTCCCCTAAAAGACTTCTGCAGG - Intergenic
1162085446 19:8246255-8246277 GTACCCTTAAAGATGTGTGCGGG + Intronic
1163198914 19:15748073-15748095 CTCCCCTAACAGAAGTATGAGGG + Intergenic
1164604710 19:29589455-29589477 GTCCCCTGCAAGAAATCTGCAGG + Intergenic
1164740872 19:30574616-30574638 CTCCCCTGTAAGAAGAATGCTGG - Intronic
1164850687 19:31480861-31480883 GTCCCCTTACAAAAGTTTGCCGG - Intergenic
1166494068 19:43285652-43285674 CTCTCCTACAAGAAGGATGCAGG + Intergenic
925302716 2:2828466-2828488 GACCCCTAAATGAATTAGGCGGG + Intergenic
926434555 2:12824716-12824738 ATCCCCCAAAAGAAGGAAGCAGG - Intergenic
932451138 2:71811624-71811646 GTCCCTGAAAAGTAGTCTGCTGG - Intergenic
935814615 2:106835555-106835577 TTCCCCTAAAAGAACATTGCAGG - Intronic
936643983 2:114348089-114348111 GTCCCCTAAAATTTGTATGTTGG - Intergenic
944913836 2:204337278-204337300 GAACCCCAAAAGAAGGATGCTGG + Intergenic
947115489 2:226765734-226765756 CTTCCGTAAAAGAACTATGCAGG + Intronic
1168795766 20:609520-609542 GCCCCCAAACAGAAGGATGCGGG - Intronic
1175159865 20:57000242-57000264 GCCCCACAAAAGAAGTATCCAGG - Intergenic
1178551729 21:33545898-33545920 CTCCCCTGAAAGAAATATGTGGG + Intronic
1183657664 22:39198336-39198358 CTCCCCCAAAAGAAGTCTTCAGG + Intergenic
1184840491 22:47049868-47049890 GTCCCGTAAAAGAGGTGTTCAGG + Intronic
1184965925 22:47972321-47972343 GTCCCCTCTAAGAACTATGAAGG + Intergenic
956882240 3:73522209-73522231 GGCCCTTTAAAGAAGTATGCTGG + Intronic
960058815 3:113297797-113297819 GTCCCCTAAGAGAAGTTTGAAGG + Intronic
963527306 3:146430763-146430785 GTCTCCTCCAAGAGGTATGCAGG + Intronic
966952476 3:184834364-184834386 ATCTCCTAAAAGAGGTATGACGG - Intronic
967852761 3:194094427-194094449 GTCTCAGAAAAGAAATATGCTGG + Intergenic
970648864 4:18155901-18155923 CTCCCCTAGAAGAAGTAAGGAGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
974412487 4:61560129-61560151 GTGCCATAATAGAAGTATGGAGG - Intronic
976319057 4:83690756-83690778 GTACCCTATAAGAAGTTTGAGGG - Intergenic
979245787 4:118502817-118502839 GTCACCTGAAAGAACCATGCAGG - Intergenic
982103601 4:151992487-151992509 CACCCCTAAAAGATGTATGATGG - Intergenic
984188769 4:176579339-176579361 GTCCCATCTAAGAAGGATGCTGG + Intergenic
986065739 5:4231861-4231883 GTTCCATCAAAGAAGTAGGCAGG - Intergenic
988038630 5:25860114-25860136 GGCCCCTAACAGAATAATGCTGG + Intergenic
988987342 5:36633561-36633583 GTCCCCAAGAAGATGTATGTTGG + Intronic
990029397 5:51238664-51238686 GTCACCTAAAAGAATAATGATGG - Intergenic
990547412 5:56836752-56836774 GTCCCCTAAAAGAAGTATGCTGG - Intronic
995329742 5:110933699-110933721 GACCCCTTAAAGAAGTAGTCTGG + Intergenic
997011250 5:129881001-129881023 ATTCCCCAAAAGAAGGATGCTGG + Intergenic
999366222 5:151025412-151025434 ATCCCCTTCAAGCAGTATGCTGG + Exonic
1000614355 5:163411279-163411301 GGCCCCTGAAAGATGTATCCAGG + Intergenic
1006590779 6:35155021-35155043 CTCACCTCAAAGAAATATGCGGG + Intergenic
1008252356 6:49255838-49255860 CTGCCGTGAAAGAAGTATGCTGG + Intergenic
1012225926 6:96703354-96703376 GTCCCCTTGAAGAAGCATCCAGG + Intergenic
1012570536 6:100721444-100721466 GTCTCATAAAAGAAGCATTCAGG - Intronic
1020318473 7:6923837-6923859 GTCCCTTTAAAGAAAGATGCCGG - Intergenic
1021526681 7:21595854-21595876 GTCTCCTAAGAGAAGAATGGTGG - Intronic
1027437572 7:78180768-78180790 GACCCCTTAGAGAAGAATGCTGG + Intronic
1029152304 7:98489634-98489656 GTCCCCCAAAAGACATATCCAGG + Intergenic
1029968789 7:104768713-104768735 GTCATCTAAAAGGAGGATGCTGG - Intronic
1036988303 8:13562122-13562144 GTACACTAAAAGAAGTAATCGGG + Intergenic
1039369318 8:36968766-36968788 GCCCCTTGAAATAAGTATGCTGG - Intergenic
1042908536 8:73800310-73800332 GTCCCTTAAAAGGAGAATGGTGG + Intronic
1043911198 8:85866315-85866337 CTTCTCTAAAAGAAGCATGCAGG + Intergenic
1046624450 8:116561923-116561945 CTCCCCTAAAAGCTGTATGAGGG + Intergenic
1050192559 9:3043588-3043610 GTCCCCAGAATGAAGTCTGCCGG + Intergenic
1050694280 9:8261658-8261680 GTTCCCTAATAGGAGTTTGCTGG + Intergenic
1051184350 9:14442787-14442809 GTCCCCTCAAAAAGGTATGTTGG - Intergenic
1051934212 9:22424883-22424905 GTAACCTTAAACAAGTATGCAGG + Intergenic
1053179102 9:35952634-35952656 TCCCCCTGAAAGAAATATGCGGG + Intergenic
1055604212 9:77951032-77951054 GTGCCCTAAACAAAGTATACTGG - Intronic
1055660342 9:78496910-78496932 GTCTATTAAAAGAAGTATTCTGG - Intergenic
1056079856 9:83080563-83080585 TTTCCCTAAAAGAATTATTCAGG + Intergenic
1059030785 9:110693523-110693545 GTCACCTTAAAGCAGGATGCTGG - Intronic
1059734066 9:117084408-117084430 GTCCCCTAAGAGAACTTTGTAGG - Intronic
1186442700 X:9599864-9599886 CTCCCCAAAAAGAAGTTTCCTGG - Intronic
1194385842 X:93254381-93254403 GTCCCCTTGAAGAAGGATCCTGG - Intergenic
1196655861 X:118216514-118216536 GTCCCCTCTAAGAAGTTAGCAGG + Intergenic
1200182376 X:154158600-154158622 GTCCCCCAAAAGATGTGTTCAGG - Intronic
1200188030 X:154195714-154195736 GTCCCCCAAAAGATGTGTTCAGG - Intergenic
1200193680 X:154232854-154232876 GTCCCCCAAAAGATGTGTTCAGG - Intronic
1200199435 X:154270658-154270680 GTCCCCCAAAAGATGTGTTCAGG - Intronic
1201786187 Y:17783076-17783098 GTACTTTAAAAGAATTATGCAGG + Intergenic
1201815366 Y:18122912-18122934 GTACTTTAAAAGAATTATGCAGG - Intergenic
1201898338 Y:19018513-19018535 CTCCCCCAAAAGAAGTCTCCAGG + Intergenic