ID: 990550491

View in Genome Browser
Species Human (GRCh38)
Location 5:56872297-56872319
Sequence ATCTGGAAGGTATACATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990550491 Original CRISPR ATCTGGAAGGTATACATGAA GGG Intronic
900920974 1:5670133-5670155 ATCTGGAAGATATTGTTGAAGGG + Intergenic
903263713 1:22144077-22144099 TTGTGGAAGGAATAAATGAATGG + Intergenic
905216637 1:36413066-36413088 ATCTAGAATGTACACATGTATGG + Intergenic
905486942 1:38306286-38306308 ATTAGGAAGGGACACATGAAGGG - Intergenic
906363174 1:45181452-45181474 ATCTGATTGGTATACCTGAAAGG + Intronic
907753883 1:57290516-57290538 ATCTGGAGGGTAAACAGGGATGG + Intronic
915837895 1:159192513-159192535 GATTGGAAGGTAAACATGAAAGG + Intronic
920837158 1:209521736-209521758 ATCTGGAAAATATACTTGAAGGG - Intergenic
921807034 1:219467053-219467075 ATCTGGAATATATTCATGAAGGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924216596 1:241828614-241828636 ATTTGGAAGCAAAACATGAATGG + Intergenic
1064166848 10:12994038-12994060 ATCTGGACTGTAGATATGAAGGG - Intronic
1065417348 10:25502758-25502780 ATGTGAAAGGTACACATGCAGGG - Intronic
1067368437 10:45659047-45659069 AACTGGAAGGAACACTTGAATGG + Intronic
1067526603 10:47043080-47043102 ATCTGGATGGTAAAGATGAGTGG + Intergenic
1068936190 10:62637888-62637910 ATCTGGAAGGAAAACAAGAAAGG + Intronic
1069115553 10:64501613-64501635 ATCTAGAAGGAAAAAATGAAAGG + Intergenic
1071107372 10:82114048-82114070 CTCTGGACGTTTTACATGAATGG + Intronic
1074296628 10:112195260-112195282 ATCTGTAAGGAATATATGGAAGG - Intronic
1074339149 10:112609537-112609559 ATGTTGAATGGATACATGAATGG + Intronic
1074905646 10:117861218-117861240 ATCAGGAAGTTAGAAATGAATGG - Intergenic
1075287231 10:121197421-121197443 CTCTGAAAGTCATACATGAAGGG + Intergenic
1075288439 10:121207452-121207474 AGCTGGAAGGGAAAGATGAATGG - Intergenic
1077797834 11:5509694-5509716 ATCTGCAGGGTCTACATGAAAGG + Intronic
1078188974 11:9075908-9075930 TTCTGGAAGGGACACATGGAAGG + Intronic
1078290299 11:10004150-10004172 ATCTGGAGGGTAGATTTGAAGGG - Intronic
1078541082 11:12213608-12213630 TTCTGGATGTTGTACATGAAAGG + Intronic
1078678126 11:13446204-13446226 ATATAGAAGGTATACAGGAGTGG - Intronic
1080499084 11:32851415-32851437 ATCTGGAATGTATTCATGGTAGG - Intronic
1082764961 11:57160005-57160027 ATCTGGGAGTTTTCCATGAAGGG - Intergenic
1085982018 11:81736493-81736515 ATCTTGAAGGAAAACAGGAAGGG + Intergenic
1086005884 11:82035220-82035242 TTCTGTAAGCTATACAAGAATGG + Intergenic
1087030923 11:93703528-93703550 ATTTAGAAGGCAGACATGAAAGG - Intronic
1087136756 11:94728938-94728960 ATCTGAAAGCTATACATACAAGG + Intronic
1087587314 11:100138932-100138954 ATTTGGAAGGTAGAAATGACAGG + Intronic
1088687442 11:112296854-112296876 GTCTTGAAGTTTTACATGAAAGG - Intergenic
1089377608 11:118005659-118005681 ATCTGGAAGGTAGAGCTGATAGG - Intergenic
1089410920 11:118242048-118242070 AACTGGAAGGTGGAAATGAATGG + Intronic
1089429499 11:118410899-118410921 AAGGGGAAGGTATACTTGAAAGG + Intronic
1092299728 12:7235278-7235300 AACAGGAAGGTATTCATCAAAGG + Intergenic
1094778067 12:33755489-33755511 ATCTGGAAGGACTAGGTGAAAGG + Intergenic
1094853840 12:34394193-34394215 ATGTGGAAGGAAAACACGAACGG + Intergenic
1094854336 12:34396257-34396279 ATGTGGAAGGAAAACACGAAGGG + Intergenic
1096104635 12:48989832-48989854 ATGTGGAATGTATAGATGGATGG + Intergenic
1097243587 12:57592606-57592628 ACCTGGAAGGTACATATGAGAGG - Intronic
1100610717 12:96190204-96190226 TTCTGGAAGGTACACAGGCAGGG - Intergenic
1100974502 12:100108324-100108346 ATATAGAAGGAAAACATGAAAGG + Intronic
1102096898 12:110248048-110248070 ATCGTGAAAGTATGCATGAAAGG + Intergenic
1104326222 12:127801299-127801321 ACATGGAAGGTGTACATGGAAGG - Intergenic
1106692240 13:32130769-32130791 ATCTAAAAGGTAAAGATGAATGG - Intronic
1108007649 13:45967625-45967647 AACTGGAAGGTGAACATGAAAGG - Exonic
1108171751 13:47749094-47749116 AACTGGCAGGTATAGATTAAAGG + Intergenic
1114553020 14:23544965-23544987 AGCGGGAAGGGAGACATGAAAGG - Intronic
1115259184 14:31436006-31436028 TTCAGGAAGTTATAGATGAAGGG - Intronic
1116023043 14:39484600-39484622 ATATGAAGGGTATAAATGAAGGG - Intergenic
1116589858 14:46758466-46758488 GTCTTGAAGATATACATTAAAGG + Intergenic
1121596630 14:95168322-95168344 ATCTGGAGGCTATACAAGCATGG - Intergenic
1125471684 15:40010718-40010740 ATCTGGCAGGTACACATCAATGG + Intronic
1127210312 15:56767839-56767861 ATGTGAATGGTTTACATGAAAGG + Intronic
1127692263 15:61408943-61408965 ATCTTGAAGCAAAACATGAATGG + Intergenic
1128917221 15:71574206-71574228 ATGTTGAATGCATACATGAAGGG - Intronic
1131546115 15:93316888-93316910 ATCTGGAAGGGAGATTTGAATGG + Intergenic
1137298565 16:47122783-47122805 ATCTGGAAGGAATACATGAAAGG + Exonic
1138227200 16:55306376-55306398 ATTTGGGAGGTACACATGCAAGG - Intergenic
1140293580 16:73686923-73686945 CTCTGGAAGGTGTACAAAAAAGG - Intergenic
1141338130 16:83176657-83176679 ATCTGCAAGGAATACATTTATGG + Intronic
1142841809 17:2637833-2637855 ATCTGGCAGGTTAACATGATTGG + Intronic
1143187526 17:5019650-5019672 ATCTGGAAGGCAGAAATGACAGG + Intronic
1143798835 17:9360559-9360581 ATCTGGAAGGAAAACAGAAAAGG - Intronic
1143915459 17:10289160-10289182 ACCTGGAAGGTCCACATGGATGG - Intergenic
1144341766 17:14315989-14316011 TGCTGGAAGGTATGAATGAAAGG - Intronic
1149150976 17:53563639-53563661 ATATGGAAGGTACTCATTAAGGG - Intergenic
1149278433 17:55072061-55072083 AGGTGGAAGGTATACCTGTATGG + Intronic
1150582618 17:66489020-66489042 AGCTGGAAGGGATTAATGAAAGG - Intronic
1154384930 18:13884680-13884702 CTCCGGAAGGCATATATGAAGGG + Exonic
1155733301 18:29189044-29189066 AACTGCAAGGAATACTTGAAAGG - Intergenic
1157037542 18:43993580-43993602 ATGTAGAAGGTAGACATAAATGG - Intergenic
1159521055 18:69524859-69524881 AATTGGAAGGAATACATGACTGG - Intronic
1162451802 19:10759538-10759560 CTCAGGAAGGTATGCATGGAAGG - Intronic
1168133063 19:54332943-54332965 ATCTTGAAGGTGCCCATGAAGGG + Intergenic
925624904 2:5832940-5832962 ATTTGCAAGACATACATGAAAGG - Intergenic
926378596 2:12261082-12261104 ATGTGGAAGGAATAAAAGAATGG + Intergenic
929098904 2:38290430-38290452 ATCAGGAAGGAATACAGAAATGG - Intergenic
932623818 2:73283278-73283300 CTCTGGGAGGTATACATGTTGGG - Intronic
935428384 2:102945395-102945417 ATCTGGAAGCTTTATTTGAATGG + Intergenic
936475285 2:112834216-112834238 ATAGAGAAGGTATACATGTATGG - Intronic
938700800 2:133877613-133877635 TTCTGGAAGGTATAGAGAAAGGG - Intergenic
939011207 2:136847782-136847804 ATGTGTAAGGTAAACATTAAAGG - Intronic
941278071 2:163516071-163516093 CTCTGGAAGGTGGACCTGAATGG - Intergenic
941470280 2:165876580-165876602 ATCTGTACTGTATAAATGAATGG - Intronic
942208982 2:173651637-173651659 ATCTGGATGCTAAACAGGAAAGG - Intergenic
942634165 2:177984139-177984161 ATTTGAAACGTAGACATGAATGG + Intronic
942883982 2:180899835-180899857 ATCTGGAAAGTATATGAGAAAGG + Intergenic
942895784 2:181052687-181052709 AACTGGGAGGTAAACAGGAAAGG - Intronic
943078803 2:183231632-183231654 ATCTCTAATGTATAAATGAAAGG - Intergenic
943609537 2:190015710-190015732 AACTGGAACTTATACATAAAAGG - Intronic
945906791 2:215603179-215603201 ATATGGAATGCATAAATGAATGG + Intergenic
946669083 2:222083120-222083142 TTCTGGAAGCCATACATGAAAGG + Intergenic
947159985 2:227204731-227204753 ATATGGAAGCTACGCATGAACGG - Intronic
948379282 2:237541632-237541654 AGCAAGAAGGAATACATGAAGGG - Intronic
1169990239 20:11495061-11495083 ATCTGGATGTTGTACATGAATGG - Intergenic
1170618928 20:17977956-17977978 AGCTTCAAGGTTTACATGAACGG - Intronic
1173339454 20:42140648-42140670 ATATGGAAGGTATACTTGATTGG - Intronic
1177677527 21:24320923-24320945 AACTGGAAAGTATACATTATTGG + Intergenic
1180237063 21:46468551-46468573 ATCTGGAAGGTGTTGATCAAAGG + Intronic
1180319179 22:11305166-11305188 ATCTGGAAGATATTGTTGAAGGG - Intergenic
1183504225 22:38200205-38200227 ATGTTGAAGGAATACATGACTGG - Intronic
951616435 3:24551262-24551284 AAATGTAAGGTATACATGAGTGG - Intergenic
952002088 3:28797764-28797786 AACTGGCAGGTAAACAGGAAGGG + Intergenic
953850204 3:46460163-46460185 ACCTGGAAGGTAGGCAGGAAAGG + Intronic
954126717 3:48535474-48535496 ATCTGGGAGGTAGACAGGGAGGG + Intronic
956401374 3:68883474-68883496 ACCTGTAAGGCATAGATGAAGGG - Intronic
958122071 3:89303910-89303932 ATTTGGCAGAAATACATGAAGGG - Intronic
958673952 3:97242035-97242057 TTCAGGAAGGCAAACATGAAGGG - Intronic
959266438 3:104146207-104146229 ATGGGAAAGATATACATGAATGG + Intergenic
965096983 3:164242435-164242457 ATCTGGAAGAGATACTTGCAGGG - Intergenic
965924518 3:173960882-173960904 ATCTGTAAAGTATATATTAAAGG - Intronic
966482027 3:180421079-180421101 ATCTGGAAGGAATATACCAAAGG + Intergenic
966663588 3:182445128-182445150 ATCAGTAAAGTCTACATGAAGGG - Intergenic
967612644 3:191525862-191525884 ATCTGGAGAGTGTACATGAGGGG + Intergenic
967883729 3:194319141-194319163 AGTTGGAACTTATACATGAAAGG - Intergenic
969950970 4:10835200-10835222 ATCTGGAGTGTTTACATGAATGG + Intergenic
970772399 4:19629429-19629451 ATCTGGAGGGAATTCAAGAAAGG + Intergenic
971222864 4:24725008-24725030 TTCTGGAAAGTCTACCTGAAGGG + Intergenic
971350639 4:25852769-25852791 GTTTTTAAGGTATACATGAAAGG - Intronic
974092490 4:57326545-57326567 ATCTCCAAGTTATACTTGAAGGG + Intergenic
974277156 4:59737128-59737150 ATTTGGAAGATATACAGAAAAGG - Intergenic
975056379 4:69936447-69936469 ATCCCTAAGGAATACATGAATGG + Exonic
975899990 4:79140306-79140328 ATCTCCAAGGTCAACATGAAAGG - Intergenic
976577362 4:86689687-86689709 ATCTGGCAGGGATACAAGCATGG - Intronic
976979810 4:91213455-91213477 ATTTGGAATGTTTACATGAATGG - Intronic
977375583 4:96198500-96198522 GTTTGGAGGGTATACAAGAAAGG + Intergenic
983309189 4:166035591-166035613 ATCTGGAAGCTATTCTTGATTGG - Intronic
985991161 5:3562881-3562903 ATTTGCAAAGTATACATCAATGG - Intergenic
989393352 5:40925131-40925153 AGTTGGAATTTATACATGAAAGG - Intronic
990075356 5:51839235-51839257 ATCTAGTAGGTAAACATGAATGG + Intergenic
990550491 5:56872297-56872319 ATCTGGAAGGTATACATGAAGGG + Intronic
993953577 5:94204805-94204827 ATATGGAAGTTATTCCTGAATGG - Intronic
995896553 5:117019052-117019074 ATCTGGAATTTATGCATCAATGG + Intergenic
996165692 5:120220143-120220165 ATCTGCCAGATCTACATGAAAGG + Intergenic
998769110 5:145521595-145521617 ATCTGGAATGGATACATTCAAGG + Intronic
999723207 5:154413911-154413933 ATCTAGAATATATAAATGAAAGG + Intronic
1000979038 5:167797033-167797055 ATCTGGATGGTATTCAAGAGGGG - Intronic
1001650084 5:173309933-173309955 ATCTGGAGGGGTTACAGGAATGG + Intergenic
1003003650 6:2360699-2360721 ATCTAGATGGTATATATTAAGGG - Intergenic
1003766299 6:9240956-9240978 ATCTAGAAGGTCTAGAAGAATGG - Intergenic
1006033512 6:31194888-31194910 ATGTGGAAGGTAGTCCTGAAAGG - Intergenic
1006056809 6:31391214-31391236 ATCTGGAAGGTGGTCCTGAAAGG - Intergenic
1006069518 6:31488115-31488137 ATCTGGAAGGTGGTCCTGAAAGG - Intergenic
1006654555 6:35579327-35579349 ATCTTAAAGGTAGACATAAAAGG - Intronic
1007728996 6:43934491-43934513 AACTGGAACATATGCATGAAGGG - Intergenic
1009818604 6:68770198-68770220 CTCTGGAAGGAATACATTAAGGG + Intronic
1012535087 6:100286174-100286196 ATCTGTAAGGCATACATAAATGG + Intergenic
1018049030 6:159991698-159991720 AGCTGGAAGGTACAAAGGAATGG - Intronic
1020641197 7:10755868-10755890 ATATGGAAGTGCTACATGAAAGG - Intergenic
1021619951 7:22541538-22541560 ATCTGGAAGGGACACATCAATGG + Intronic
1022175773 7:27870371-27870393 ATGTGGAATTCATACATGAAAGG - Intronic
1024261577 7:47577660-47577682 ATCAGGATGGCATACATGCACGG + Intronic
1024750151 7:52455669-52455691 ATCTGGAAGGAATAGAAGAGTGG + Intergenic
1025960788 7:66219356-66219378 AACTGGAAAATATACAGGAAAGG + Intronic
1027833024 7:83204884-83204906 ATCTGGGAGGTATAGTTAAATGG + Intergenic
1029898670 7:104015542-104015564 TTCTGGAAGATACACAAGAATGG + Intergenic
1033277590 7:139984361-139984383 ATGTGGAAGGGACACATGGAAGG - Intronic
1033888715 7:145980841-145980863 ATATGCATGTTATACATGAAAGG - Intergenic
1036163855 8:6413075-6413097 TTCTGGAAAGGATACATAAAAGG + Intronic
1039294128 8:36130767-36130789 CTCTGAAAGGAATAAATGAATGG - Intergenic
1041887633 8:62830107-62830129 CTCTGAAAGGTAGAAATGAAAGG + Intronic
1042643624 8:70961321-70961343 ATCTGGAAGTTAGATATGACAGG + Intergenic
1043746765 8:83882789-83882811 ATCAGGAAAATTTACATGAATGG + Intergenic
1044526647 8:93260095-93260117 ATCTGGAAGGTATCCTTTCAGGG + Intergenic
1044588521 8:93890798-93890820 ATCTGGGAGGTATGCGTAAATGG - Intronic
1044756616 8:95469202-95469224 ATCTGGAGTGTATAAATAAAAGG + Intergenic
1046568657 8:115934285-115934307 ATCTGAAAGGTACACAAAAAGGG - Intergenic
1047875543 8:129133430-129133452 ATCTGGAAGGTATTCTTCAGGGG + Intergenic
1048379089 8:133848034-133848056 ATCTGGAATGTATAGATGATGGG - Intergenic
1048901421 8:139041584-139041606 ATCTGAAAAGTCTACAAGAAAGG + Intergenic
1049045573 8:140148669-140148691 AGCTGGAAGGCATACCGGAAAGG - Intronic
1050335528 9:4586476-4586498 ATCTGGAAGTTGTAAATGAATGG - Exonic
1052334798 9:27308306-27308328 TTCTGGAAGATATAAATGAGGGG - Intergenic
1055213699 9:73832344-73832366 TTGTGGAAGGAATAAATGAATGG - Intergenic
1056185652 9:84132158-84132180 ATTTATTAGGTATACATGAAAGG + Intergenic
1056187770 9:84152693-84152715 ATCTGCATGGTGTACATAAATGG - Intergenic
1058701496 9:107604471-107604493 ATCTTGAAGGGACACATAAATGG - Intergenic
1059592170 9:115673400-115673422 TTAAGGAAGGTACACATGAAAGG + Intergenic
1203367407 Un_KI270442v1:270915-270937 ATCTGGAAGATATTGTTGAAGGG - Intergenic
1186601201 X:11039194-11039216 ATCTGGAACAGATACATGAATGG - Intergenic
1188269417 X:28120195-28120217 ATGGGGAAGGGATACAGGAAGGG + Intergenic
1189782061 X:44524870-44524892 ACCTGTAAGGTAGAGATGAATGG + Intronic
1194121890 X:89972616-89972638 ATCTTAAAGGTATACGGGAAAGG + Intergenic
1195393150 X:104384071-104384093 GTCAGGAAGGTACACTTGAATGG + Intergenic
1199038396 X:143080240-143080262 ATCTGGGAGGTATACAAGTTTGG - Intergenic
1200474743 Y:3630053-3630075 ATCTTAAAGGTATACGGGAAAGG + Intergenic
1201071286 Y:10149315-10149337 ATCTGGAAGATATTGTTGAAGGG + Intergenic
1202167748 Y:22010505-22010527 ATCTGGTGGCCATACATGAAAGG - Intergenic
1202223613 Y:22575864-22575886 ATCTGGTGGCCATACATGAAAGG + Intergenic
1202319503 Y:23619797-23619819 ATCTGGTGGCCATACATGAAAGG - Intergenic
1202551266 Y:26050260-26050282 ATCTGGTGGCCATACATGAAAGG + Intergenic