ID: 990550741

View in Genome Browser
Species Human (GRCh38)
Location 5:56875623-56875645
Sequence GTGGAAAAGGAGGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2606
Summary {0: 1, 1: 4, 2: 52, 3: 368, 4: 2181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990550741_990550748 14 Left 990550741 5:56875623-56875645 CCTTCCTCATCCTCCTTTTCCAC 0: 1
1: 4
2: 52
3: 368
4: 2181
Right 990550748 5:56875660-56875682 AGACTAAAAACCATGGCTTCAGG 0: 2
1: 54
2: 56
3: 57
4: 230
990550741_990550747 7 Left 990550741 5:56875623-56875645 CCTTCCTCATCCTCCTTTTCCAC 0: 1
1: 4
2: 52
3: 368
4: 2181
Right 990550747 5:56875653-56875675 TAGAGACAGACTAAAAACCATGG 0: 2
1: 1
2: 3
3: 42
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990550741 Original CRISPR GTGGAAAAGGAGGATGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr