ID: 990550747

View in Genome Browser
Species Human (GRCh38)
Location 5:56875653-56875675
Sequence TAGAGACAGACTAAAAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 2, 1: 1, 2: 3, 3: 42, 4: 342}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990550743_990550747 -3 Left 990550743 5:56875633-56875655 CCTCCTTTTCCACTTACCACTAG 0: 1
1: 8
2: 28
3: 53
4: 242
Right 990550747 5:56875653-56875675 TAGAGACAGACTAAAAACCATGG 0: 2
1: 1
2: 3
3: 42
4: 342
990550740_990550747 18 Left 990550740 5:56875612-56875634 CCAGTAAAGCTCCTTCCTCATCC 0: 2
1: 53
2: 57
3: 64
4: 417
Right 990550747 5:56875653-56875675 TAGAGACAGACTAAAAACCATGG 0: 2
1: 1
2: 3
3: 42
4: 342
990550744_990550747 -6 Left 990550744 5:56875636-56875658 CCTTTTCCACTTACCACTAGAGA 0: 1
1: 3
2: 8
3: 16
4: 181
Right 990550747 5:56875653-56875675 TAGAGACAGACTAAAAACCATGG 0: 2
1: 1
2: 3
3: 42
4: 342
990550742_990550747 3 Left 990550742 5:56875627-56875649 CCTCATCCTCCTTTTCCACTTAC 0: 1
1: 0
2: 18
3: 115
4: 1055
Right 990550747 5:56875653-56875675 TAGAGACAGACTAAAAACCATGG 0: 2
1: 1
2: 3
3: 42
4: 342
990550741_990550747 7 Left 990550741 5:56875623-56875645 CCTTCCTCATCCTCCTTTTCCAC 0: 1
1: 4
2: 52
3: 368
4: 2181
Right 990550747 5:56875653-56875675 TAGAGACAGACTAAAAACCATGG 0: 2
1: 1
2: 3
3: 42
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990550747 Original CRISPR TAGAGACAGACTAAAAACCA TGG Intronic
900304323 1:1996389-1996411 TAGAAACAGACAAAAAACTTAGG + Intronic
902507263 1:16946516-16946538 CAGAGACAGACAGAGAACCAGGG - Intronic
902889007 1:19427970-19427992 TAGAGACAAACACAAAACCCTGG + Intronic
902952412 1:19896591-19896613 TAAAGACAAAGCAAAAACCATGG - Intronic
903763582 1:25716975-25716997 TATGGACAGACAAAACACCATGG - Intronic
906219548 1:44068223-44068245 TTGAGACAGCCTAAACAACATGG - Intergenic
907374952 1:54029080-54029102 TCCAGACAGACTAATAACAAAGG + Intergenic
907564806 1:55424897-55424919 CAGAGCCAGAATAATAACCAAGG + Intergenic
908583065 1:65538236-65538258 TAAAAACAGAATAAACACCAGGG - Intronic
908913098 1:69095764-69095786 TAGAAACAAAGTAAAAACAAAGG - Intergenic
909359730 1:74746287-74746309 TAGAGACAGTCTCCAAAACATGG + Intronic
910256467 1:85253090-85253112 GAGACAGAAACTAAAAACCATGG - Intronic
910395407 1:86788788-86788810 TATGCACAGACTAAAAACTAGGG - Intergenic
911044757 1:93619250-93619272 GAGACAGAAACTAAAAACCATGG - Intronic
911705892 1:101012310-101012332 GAGACAGAAACTAAAAACCATGG - Intronic
912151709 1:106867198-106867220 TAGTGACTCACTAAAAACAAAGG - Intergenic
912328043 1:108787439-108787461 GAGACAGAAACTAAAAACCATGG + Intronic
913175057 1:116266001-116266023 GAGACAGAAACTAAAAACCATGG - Intergenic
917457670 1:175199421-175199443 TAGGGAAAGACTCAAAACAATGG + Intergenic
917882169 1:179347875-179347897 TAGAGACAGAAGAAAACACAAGG - Intronic
918108785 1:181437574-181437596 TAAAGACAGAGAAAGAACCATGG - Intronic
918268039 1:182865689-182865711 TATAGACAGAATCAAATCCAAGG + Intronic
918335072 1:183501649-183501671 TAGAGACAGACCAACAAGGAAGG - Intronic
919425243 1:197421737-197421759 TGGAGACAGCCTACAAACGAAGG - Exonic
919800243 1:201349705-201349727 GAGAGACGGACAAAAAAACAAGG + Intergenic
919909405 1:202101574-202101596 GAGAGAGAGAAAAAAAACCATGG - Intergenic
920102883 1:203529026-203529048 TAGAGACAGACTGAAAACCCAGG - Intergenic
920511282 1:206554130-206554152 TATAGAGAGGCTGAAAACCAGGG - Intronic
921093654 1:211867804-211867826 AAAAGACAGGCTAAGAACCATGG - Intergenic
921139506 1:212293019-212293041 GAGACAGAAACTAAAAACCATGG + Intronic
923699655 1:236287805-236287827 GAGACAGAAACTAAAAACCATGG + Intergenic
924168587 1:241312280-241312302 GAGAAACAGACTACAAACAATGG + Intronic
1063773576 10:9232852-9232874 AAGAGACAGATTAAACACCCAGG - Intergenic
1064378403 10:14817740-14817762 AAAAAACAGACTAAACACCATGG + Intergenic
1064975828 10:21113697-21113719 TCCATACAAACTAAAAACCAAGG - Intronic
1065778013 10:29140381-29140403 TAGGGAAAGAGTAAAAACAATGG - Intergenic
1066156682 10:32685428-32685450 GAGACAGAAACTAAAAACCATGG - Intronic
1066638957 10:37536435-37536457 GAGACAGAAACTAAAAACCATGG - Intergenic
1066687078 10:37991593-37991615 GAGACAGAAACTAAAAACCATGG - Intergenic
1067152180 10:43745822-43745844 TACAGTCAGACTAACAACCCTGG + Intergenic
1067488903 10:46679270-46679292 CAGACAGAAACTAAAAACCATGG + Intergenic
1067605765 10:47661106-47661128 CAGACAGAAACTAAAAACCATGG - Intergenic
1067662843 10:48249485-48249507 TAGAGACAGACCAGGATCCAAGG + Intronic
1067943821 10:50678217-50678239 TAGTGACCAACCAAAAACCAGGG - Intergenic
1068037373 10:51777789-51777811 TAGAGACAGTAAAAAAATCAAGG - Intronic
1068040651 10:51819707-51819729 AAGAGCCAGAATACAAACCAGGG + Intronic
1068487157 10:57674490-57674512 TAGAGACAGACTTAAAACTTGGG + Intergenic
1068839957 10:61600821-61600843 AAAAGACAGTCTAAAAACCAAGG - Intergenic
1070865310 10:79705086-79705108 TAGTGACCAACCAAAAACCAGGG - Intronic
1070879102 10:79843217-79843239 TAGTGACCAACCAAAAACCAGGG - Intronic
1071621324 10:87122465-87122487 CAGACAGAAACTAAAAACCATGG - Intronic
1071632209 10:87227307-87227329 TAGTGACCAACCAAAAACCAGGG - Intronic
1071645662 10:87359526-87359548 TAGTGACCAACCAAAAACCAGGG - Intronic
1071868864 10:89769364-89769386 GAGACAGAAACTAAAAACCATGG + Intronic
1072269658 10:93763827-93763849 TGCAGTCTGACTAAAAACCAAGG - Intronic
1072546251 10:96441772-96441794 TTGAGACAGGCTAAAAAGGAAGG + Intronic
1072772724 10:98155140-98155162 CAGAGACAGATTAAAAACATTGG - Intronic
1072877284 10:99186039-99186061 TAGTGACAGACAATAAACCATGG + Intronic
1073027052 10:100495719-100495741 TAGAGACAAACCAAAAACCATGG - Intronic
1073074265 10:100813825-100813847 TAGAGACATTCTAAAATCCAGGG + Intronic
1073401895 10:103264474-103264496 TAGAGACAGAAAATAAAACAGGG + Intergenic
1076238386 10:128883484-128883506 TAGTGGCAGAGTAAAAACGATGG - Intergenic
1078105133 11:8353661-8353683 TTGAGACAGCCGAAAAACAATGG - Intergenic
1078379257 11:10825312-10825334 AAGAGAAAGATTAAAAGCCAAGG + Intronic
1078727883 11:13948078-13948100 GAGACATAAACTAAAAACCATGG + Intergenic
1079182578 11:18206414-18206436 AAGACACAGACTAAAAATAAAGG + Intronic
1079493053 11:21010892-21010914 TAGAGACAGACTGAACAGAAAGG - Intronic
1079944847 11:26729269-26729291 GAGACAGAAACTAAAAACCATGG + Intergenic
1080214404 11:29824889-29824911 TGGAGACAGCCTAAAATCCATGG + Intergenic
1083706028 11:64516439-64516461 TAGAGAGAGACTAACAAGCTGGG - Intergenic
1086058407 11:82675273-82675295 TAGAGGCAGACTAGAACCCAGGG - Intergenic
1088183206 11:107135373-107135395 GAGACAGACACTAAAAACCATGG + Intergenic
1088797839 11:113279044-113279066 TAGAGACATAATAAACTCCAGGG - Intergenic
1089231410 11:116980364-116980386 GAGAGAGAAACTAAAAACAATGG + Intronic
1089714512 11:120345140-120345162 GAGACAGAAACTAAAAACCATGG - Intronic
1090250475 11:125247383-125247405 TAGAGACAGTATAGAAACCCAGG - Intronic
1090426821 11:126613157-126613179 TAGAAACATATTAAAAACCATGG + Intronic
1090746283 11:129707698-129707720 GAGACAGAAACTAAAAACCATGG - Intergenic
1091356116 11:134938885-134938907 GAGACAGAAACTAAAAACCATGG + Intergenic
1093495765 12:19755406-19755428 TATAGACAGAATTAAAACAAGGG - Intergenic
1093569973 12:20655552-20655574 GAGACAGAAACTAAAAACCATGG + Intronic
1093687456 12:22072872-22072894 TAGAAACAGAAGAAAAACAAAGG + Intronic
1093817572 12:23568416-23568438 TAGAGACATGGTAAAGACCAAGG - Intronic
1095122289 12:38433750-38433772 GAGAGACAGCCTAAAAATAAAGG - Intergenic
1095738005 12:45578689-45578711 TGGAGACATCTTAAAAACCAAGG - Intergenic
1098435623 12:70465616-70465638 TGGAAACAGAATAAAAACAAAGG + Intergenic
1098879989 12:75907326-75907348 TAGAGACAGACAAACACACAGGG - Intergenic
1099174961 12:79410465-79410487 CAGATGCAGACTTAAAACCATGG + Intronic
1099358312 12:81665717-81665739 TAGAGGCAGACCAAAAGCAATGG + Intronic
1099470446 12:83041589-83041611 AAGAGACACAGTAAAAACCTAGG + Intronic
1100042801 12:90341350-90341372 TAGAAACAGAAGAAAAACAAAGG + Intergenic
1100372114 12:93978043-93978065 GAGAGAGAGACTATAAACCAAGG + Intergenic
1101274446 12:103183888-103183910 TAGAGAGAAACTAGAAAACAAGG - Intergenic
1103197440 12:119057125-119057147 AAAAGAAAGAATAAAAACCATGG - Intronic
1103310458 12:120002819-120002841 TGGAGACTGACTAGAAAGCAGGG + Intronic
1103860669 12:124010714-124010736 AGGAGACAGGTTAAAAACCAGGG + Intronic
1104264479 12:127218817-127218839 TGGAGACAGAAAAAGAACCAGGG - Intergenic
1104270190 12:127276570-127276592 CAGAGACAGAATAAAATCCACGG - Intergenic
1104485244 12:129145908-129145930 GAGACAGAAACTAAAAACCATGG + Intronic
1104513203 12:129400429-129400451 GAGACAGAAACTAAAAACCATGG - Intronic
1104538261 12:129639080-129639102 TTGAGACACATTAAAAATCAGGG + Intronic
1105995668 13:25669658-25669680 AAGGGACAGACCAAAAAGCAGGG - Intronic
1105995679 13:25669727-25669749 AACAGACAGACCAAAAAGCAGGG - Intronic
1106009689 13:25807975-25807997 AAGAGACAGACTAAAGTGCATGG - Intronic
1107137863 13:36964248-36964270 TGGGGCCAGACTAAAGACCATGG + Intronic
1108889420 13:55234605-55234627 AAGAGAGAGAATGAAAACCAAGG - Intergenic
1110592582 13:77282046-77282068 TAGAGACAGAGAAAAAAGGAGGG + Intronic
1111740184 13:92195202-92195224 TAGAGACAGCCAAAAAACGGTGG + Intronic
1113942584 13:114026059-114026081 CACAGACAGTCTGAAAACCATGG - Intronic
1115266249 14:31503715-31503737 TAGGGACAGCATAAAAACTAAGG + Intronic
1115273610 14:31582067-31582089 TAGAGAACTACTAAAAAACAAGG - Intronic
1115296174 14:31829637-31829659 GAGAGCTGGACTAAAAACCAAGG - Intronic
1115873166 14:37829158-37829180 AAGAGACATACCAAAAACAAAGG - Intronic
1115941966 14:38619866-38619888 CAGACACAGACTCAAAACAAAGG + Intergenic
1115975258 14:38990184-38990206 CAGACAGAAACTAAAAACCATGG + Intergenic
1116539586 14:46083372-46083394 CAGAAACAGACTAAGAAACATGG - Intergenic
1117102432 14:52364153-52364175 GAGACAGAAACTAAAAACCATGG + Intergenic
1117937394 14:60921742-60921764 TAAAGAGAAACAAAAAACCATGG - Intronic
1118369887 14:65128985-65129007 AAGGGACAGACAAAAACCCAGGG - Intergenic
1121066099 14:90966656-90966678 AAGAGGCAGACTAAAGTCCAAGG + Intronic
1124212867 15:27777371-27777393 TAGAAGCAGAGAAAAAACCAGGG - Intronic
1128005949 15:64241146-64241168 TATATACAGACTAAAAATGAAGG + Intronic
1128785818 15:70396134-70396156 AAGAGACAGACTAAACATCTTGG - Intergenic
1129017352 15:72480220-72480242 ACTAGACAGAGTAAAAACCAGGG - Intronic
1130642467 15:85691554-85691576 TAGAGACAGACTGAAAGCAGAGG - Intronic
1131176609 15:90213307-90213329 GAGAGTCAGACTGAAAGCCATGG - Intronic
1131610733 15:93959408-93959430 TAGAACCAGACTAACAACAAAGG - Intergenic
1132149562 15:99449995-99450017 TAGAAACAGCCTAAATGCCATGG + Intergenic
1133932172 16:10241561-10241583 TAAAAACAGACTAATATCCATGG - Intergenic
1134229976 16:12421341-12421363 CAGGGAGAGAGTAAAAACCAAGG + Intronic
1134814005 16:17191075-17191097 GAGACAGAAACTAAAAACCATGG - Intronic
1135102468 16:19618156-19618178 TAAAGAGAGACTACAAAACAAGG + Intronic
1135425556 16:22332511-22332533 GAGACAGAAACTAAAAACCATGG + Intronic
1135876225 16:26202767-26202789 TACAAACAGGCTAAAATCCATGG - Intergenic
1138047811 16:53744246-53744268 TAGAGACACACTAAAAAGATGGG + Intronic
1138142347 16:54579685-54579707 TAGAGACCAAATAATAACCATGG - Intergenic
1138956312 16:61974563-61974585 TAGAAACAGACTCAAAAGAAAGG + Intronic
1139026558 16:62824949-62824971 CAGAGAGAGACTGAAAACGATGG - Intergenic
1140682996 16:77403787-77403809 TAGTGAGAGACAAATAACCAAGG + Intronic
1143444913 17:7002245-7002267 TAGAAACAGACCAAAAGGCAAGG + Intronic
1144083172 17:11783171-11783193 GAGACAGAAACTAAAAACCATGG - Intronic
1144961080 17:19044489-19044511 CAGAGACAGACCATAAACAAGGG + Intronic
1144974081 17:19130035-19130057 CAGAGACAGACCATAAACAAGGG - Intronic
1146475036 17:33155968-33155990 TAGAGCCAGAATTCAAACCATGG - Intronic
1146652477 17:34615076-34615098 GAGAGACTTACTGAAAACCAGGG - Intronic
1149409392 17:56389651-56389673 TAGAGACAAACACAAAACTAAGG + Intronic
1151204651 17:72497375-72497397 AAGAGAGAGAATGAAAACCAAGG + Intergenic
1152973822 18:193408-193430 TAGAGAGAGAGTAAAAAAAAAGG - Intronic
1153030162 18:706206-706228 GAGAAACAGACTAACAGCCAAGG + Intronic
1156201045 18:34832013-34832035 TTGAGTCAGATTAAAAGCCACGG - Intronic
1157177723 18:45466602-45466624 CAGAGACAGACCAAAAACTCAGG + Intronic
1157795366 18:50569651-50569673 AAGATAGAAACTAAAAACCATGG + Intronic
1157927452 18:51781784-51781806 GAGACAGAAACTAAAAACCATGG - Intergenic
1158064140 18:53385388-53385410 TGGATACAGACTGAAAACTATGG + Intronic
1158781551 18:60658089-60658111 AAGAGAGAAACTAATAACCATGG + Intergenic
1159218963 18:65435184-65435206 AAGAGACACGCTAAAAACCAAGG + Intergenic
1160234037 18:77071480-77071502 GAGACAGAAACTAAAAACCATGG - Intronic
1160435106 18:78845595-78845617 TAGAGACAGACAAAGAGGCAGGG - Intergenic
1160604098 18:80036035-80036057 GAGAGAGAGATTAGAAACCATGG + Intronic
1163187743 19:15651311-15651333 TAGACACAGACAAAAAAACATGG - Intronic
1164771056 19:30809300-30809322 AAGAGACAGACTGAAAAGCAGGG - Intergenic
1164958784 19:32408639-32408661 TAGAGAGAGACTAAAATCTGGGG - Intronic
1166190694 19:41174757-41174779 CAGAGACAGACTGAAAACCCTGG - Intergenic
1166824753 19:45601926-45601948 TGGAGACAGACGCAAAGCCAGGG + Intronic
1167461697 19:49628148-49628170 GAGACAGAAACTAAAAACCATGG + Intergenic
1168495703 19:56847716-56847738 TAGAGACAGCCAAAAAGACATGG - Intergenic
1168566314 19:57427151-57427173 TAGAGACAGAAACAAAACCATGG - Intronic
925161857 2:1690209-1690231 CAGAAACGGACTAAAGACCAGGG - Intronic
926570853 2:14528451-14528473 TAGAGACAGAGTTATAACCAAGG + Intergenic
927443464 2:23137191-23137213 TAAAGACAGATTCAAGACCATGG + Intergenic
928601505 2:32908455-32908477 CAGAGACAGACACAGAACCATGG + Intergenic
929284587 2:40121053-40121075 GAGACAGAAACTAAAAACCATGG - Intronic
930112322 2:47689118-47689140 GAGACAGAAACTAAAAACCATGG - Intergenic
930449189 2:51512948-51512970 CAGAGACAGAATGAAAAACAGGG - Intergenic
930638228 2:53829020-53829042 CAGAGACAGAGAAGAAACCAGGG + Intergenic
932712016 2:74073186-74073208 TAGATACACACTCAAGACCAGGG - Intronic
933262153 2:80142725-80142747 GAGACAGAAACTAAAAACCATGG - Intronic
934522578 2:95028858-95028880 TAGAGACAGAACACAAACCCTGG + Intronic
934987290 2:98896792-98896814 GAGACAGAAACTAAAAACCATGG - Intronic
935018614 2:99208808-99208830 TACACACAGACTGAAAACAAAGG - Intronic
935524767 2:104152288-104152310 TAGACACAAACTAAGAACCTGGG - Intergenic
935609625 2:105007776-105007798 GAGACAAAAACTAAAAACCATGG - Intergenic
936815609 2:116456742-116456764 TAGTGACACACTTAACACCAAGG - Intergenic
938177649 2:129150412-129150434 TACAAACAGACTGAAAACAAAGG - Intergenic
939764307 2:146227141-146227163 TAGAGAAAGATTATAAACCGTGG + Intergenic
940146847 2:150554249-150554271 TAGAGCCAGAATATAAACCCAGG + Intergenic
940234806 2:151498671-151498693 TAGAAACAGACAAGAAACCAAGG + Intronic
940442622 2:153736251-153736273 TAGCAACAGACTAAAATCCATGG - Intergenic
940608195 2:155955066-155955088 AAGAGACACACCTAAAACCAGGG + Intergenic
941073456 2:160980927-160980949 AACAGACAGACTAAAAAACTTGG + Intergenic
941350462 2:164426632-164426654 TAGAGAAAAAGCAAAAACCAAGG + Intergenic
941406678 2:165098604-165098626 GAGATAGAAACTAAAAACCATGG + Intronic
941600272 2:167535015-167535037 CAGAGCCAGACTCAAACCCAAGG + Intergenic
942615108 2:177783673-177783695 TGGAAACAGAATAAAAACAAAGG - Intronic
943458563 2:188140139-188140161 TAGAGAAAGACTATACACAAAGG - Intergenic
943499151 2:188665402-188665424 GAGAGACTGACTCACAACCAGGG - Intergenic
945102326 2:206273719-206273741 TACAGAAAGAATAAAAACAATGG + Intergenic
945186039 2:207140740-207140762 TAGTAACAGACTAAAAAGAAGGG + Intronic
946064181 2:216972281-216972303 TAGAGTCAGCCTGAAGACCAGGG + Intergenic
946697619 2:222376054-222376076 TAAAGACAGACTGAAAACAAAGG + Intergenic
947092392 2:226526980-226527002 TGGAGACAGACTAAAAGGAAAGG + Intergenic
947232115 2:227898709-227898731 TATAGGCAGACTAAAAACATGGG - Intronic
948290619 2:236821632-236821654 CAGAGACAGACTAAAGATAAAGG + Intergenic
1171099013 20:22364794-22364816 TGGAGGCAGACTATAAACCAGGG + Intergenic
1171124554 20:22590349-22590371 CAGAGATGGACTAAAACCCAAGG + Intergenic
1173037250 20:39424345-39424367 GAGACAGAAACTAAAAACCATGG - Intergenic
1173724830 20:45290164-45290186 AAGAGAAAGGCCAAAAACCACGG + Intergenic
1173909435 20:46653463-46653485 GAGACAGAAACTAAAAACCATGG + Intronic
1174405379 20:50299446-50299468 TAGGGACAGCTTAAAAGCCAAGG + Intergenic
1174905252 20:54543718-54543740 GAGAAACAGATTAAAAAGCAGGG + Intronic
1178398402 21:32262692-32262714 AAGAGAAGAACTAAAAACCATGG + Intergenic
1179546864 21:42118526-42118548 AAGAGACAGAGTAGAAAGCAGGG + Intronic
1182821472 22:33220473-33220495 TAGAGACAGATAAAAGAACAGGG + Intronic
1183051912 22:35269711-35269733 TAGGGAGAGACGAATAACCAAGG + Intronic
1184985981 22:48134489-48134511 TAGAAACAGACAGAAAATCACGG + Intergenic
1185231359 22:49686022-49686044 TAGTGACAGACAGTAAACCATGG + Intergenic
949140594 3:628184-628206 TACAGACAGACTGGAGACCATGG - Intergenic
949530629 3:4951741-4951763 GAGACAGAAACTAAAAACCACGG - Intergenic
951098911 3:18663834-18663856 AATACACAGAATAAAAACCATGG + Intergenic
951860641 3:27248254-27248276 TTTAGACAGACTAAAAAAAAGGG - Intronic
951922545 3:27872323-27872345 TAGACAGAAACTAAAAACCATGG - Intergenic
953331248 3:42054516-42054538 TATAGCCAGACCAAGAACCAAGG + Intronic
955102061 3:55859837-55859859 TACAGACAGAAGACAAACCAGGG + Intronic
955439273 3:58938207-58938229 TAGAGACAGACACAAAACCCTGG + Intronic
957968583 3:87353867-87353889 TTGAAACAGACTAAAAAGTAAGG + Intergenic
959344414 3:105174758-105174780 AAGTGAGAGACGAAAAACCATGG + Intergenic
959550619 3:107651904-107651926 GAGACAGAAACTAAAAACCATGG - Intronic
960026634 3:113018575-113018597 TAGAGACAAACTAAAAACCATGG - Intronic
960028485 3:113034431-113034453 TAGACAAAGAGTAAAAAGCATGG + Intergenic
960811346 3:121630488-121630510 GAGACAGAAACTAAAAACCATGG - Intergenic
961229389 3:125289206-125289228 AAGAAACACACTAAAAAGCATGG + Intronic
961600325 3:128055995-128056017 TATAGAGAGAATAAAAAACATGG + Intronic
963417234 3:145013097-145013119 ATTAGACAGACTAAAAAACAAGG - Intergenic
963420897 3:145060371-145060393 TAGAGACATACAAAAGACTAGGG + Intergenic
964404553 3:156335323-156335345 TAGAGGCAGAAGAAAAAGCAAGG - Intronic
964664067 3:159152487-159152509 TAAAGTCAGACTAAAGACCTGGG + Intronic
964990322 3:162802798-162802820 TAGAAACAGAATAACAACCATGG + Intergenic
965077653 3:164000094-164000116 AACAGACAGATGAAAAACCATGG + Intergenic
965183820 3:165437656-165437678 TAGAAACAGCCTCAGAACCAAGG + Intergenic
965518721 3:169650941-169650963 TACATACAGACAAAAATCCAAGG + Intronic
965847078 3:172975873-172975895 TATAGAGAGACAAAAAACTAGGG + Intronic
965977258 3:174640795-174640817 TAGGGGCAGACTAAAAGCCTGGG + Intronic
968507987 4:980791-980813 GAGACAGAAACTAAAAACCAGGG + Intronic
968577259 4:1373599-1373621 AGGAGACAGAGGAAAAACCATGG - Intronic
970891630 4:21052093-21052115 TAGGAACAGACAAAAAACAAGGG - Intronic
973232387 4:47856611-47856633 TAGAAAGAGACTAAAGACAATGG - Intronic
973687440 4:53386862-53386884 GAGACAGAAACTAAAAACCATGG - Intronic
973949335 4:55995360-55995382 TAGAGACAGACTAAAAACCATGG - Intronic
973991471 4:56412672-56412694 TAGTGACTGACCAAAAATCAAGG - Intronic
974296601 4:60007782-60007804 TAGAAACACACTAAAGAACAAGG + Intergenic
974850239 4:67395586-67395608 TAAGGACAGGCTAAAATCCAGGG - Intergenic
975073965 4:70181340-70181362 GAGAGAAAGACTAAAAACAAGGG - Intergenic
975373231 4:73612438-73612460 TAGAGCCAGAATAAAAAAGATGG + Intronic
976405364 4:84656413-84656435 TGGAAACAGCCTAAACACCATGG + Intergenic
976634553 4:87274898-87274920 TAGAGGCAGAATAAAATCCATGG + Intergenic
976733892 4:88291299-88291321 TAGATATAGACTTTAAACCAGGG + Intergenic
977670309 4:99687257-99687279 TTAAGAAAGACTAAAAATCAGGG - Intergenic
977767799 4:100821034-100821056 TAGTGGTAGACTAAAATCCAAGG - Intronic
977907382 4:102493704-102493726 TATAGAAAGACTTAAAACAAAGG + Intergenic
979664423 4:123294808-123294830 TAGGTAAAGACTAAAAACCAGGG + Intronic
981199548 4:141964624-141964646 AACAGACAGACTAAAAAGCATGG + Intergenic
981842133 4:149124740-149124762 TGGTGAAAGTCTAAAAACCAGGG + Intergenic
983318450 4:166164163-166164185 TAGAGACACACTATACATCAAGG + Intergenic
983470945 4:168153375-168153397 GAGAGAGAAACTAAAAACCATGG + Intronic
984036726 4:174678135-174678157 TAAAAACACACTAAAAACAAAGG + Intronic
984133613 4:175909018-175909040 TAGAGGCAGACAAAAAAAAAAGG + Intronic
984331179 4:178321104-178321126 GAGACAGAAACTAAAAACCATGG - Intergenic
984361273 4:178736348-178736370 AAGAGACAAACGAAAAACCAGGG - Intergenic
984968496 4:185164630-185164652 GAGACAGAAACTAAAAACCATGG + Intronic
986657335 5:10028104-10028126 TAAAGACAGACTAAAAATAAAGG - Intergenic
986896882 5:12381894-12381916 GAGACAGAAACTAAAAACCATGG + Intergenic
987820548 5:22961132-22961154 CAGAGACAGAGGAAAGACCATGG - Intergenic
989059392 5:37395380-37395402 GAGACAGAAACTAAAAACCACGG - Intronic
990550747 5:56875653-56875675 TAGAGACAGACTAAAAACCATGG + Intronic
991261884 5:64676724-64676746 GAGACAGAAACTAAAAACCATGG + Intergenic
992210405 5:74474220-74474242 CACAGACACACTAAAATCCAGGG + Intergenic
992422647 5:76622004-76622026 GAGACAGAAACTAAAAACCATGG + Intronic
993442159 5:87970512-87970534 TACACACAGAATAAAAGCCAAGG - Intergenic
993831229 5:92760832-92760854 TTGAGCCTGACTATAAACCAAGG - Intergenic
994541471 5:101103914-101103936 GAGAGACAGAATAAGAAGCAAGG + Intergenic
994893473 5:105669797-105669819 TAGAGACAAAATAAAAACGATGG + Intergenic
995220572 5:109643028-109643050 TAGAGCCAGACTCGATACCAGGG + Intergenic
997583645 5:135032073-135032095 GAGAGACAGACTAAAGCCCGAGG - Intronic
998453745 5:142254410-142254432 AAGAGAGAGATTAAAAAACAGGG + Intergenic
999340671 5:150768127-150768149 TAGAGCCAGACTATGAACCCAGG - Intergenic
999482315 5:151959999-151960021 GAGACAGAAACTAAAAACCATGG - Intergenic
1001033772 5:168282056-168282078 GAGAGAGAGAAAAAAAACCAGGG + Intergenic
1001817081 5:174678660-174678682 GAGACAAAAACTAAAAACCATGG - Intergenic
1003184086 6:3815513-3815535 TAGTACAAGACTAAAAACCAGGG - Intergenic
1003253061 6:4449411-4449433 GAGACAGAAACTAAAAACCAAGG - Intergenic
1004133046 6:12939434-12939456 GGGAGACAGAGTACAAACCAGGG - Intronic
1004278140 6:14256209-14256231 TACAGGGAGACTAAAAACTAAGG + Intergenic
1005366531 6:25083830-25083852 GAGAGACAAACTAAAAACCGAGG - Intergenic
1006570367 6:34998445-34998467 TAGGAACAGACCCAAAACCAAGG + Intronic
1007006380 6:38367591-38367613 AAGAGACAGAGAAAAAACCCTGG + Intronic
1007656180 6:43452266-43452288 TTGAGACAGACTGAGAGCCAGGG - Intronic
1007709670 6:43814335-43814357 AAGAGACAGACTATAAAGAATGG - Intergenic
1008554692 6:52663567-52663589 GAGACAGAAACTAAAAACCACGG - Intergenic
1008793252 6:55265981-55266003 GAGACAGAAACTAAAAACCAGGG + Intronic
1009823190 6:68831175-68831197 TAGAGACACAATAAAAAACGTGG + Intronic
1009858947 6:69300003-69300025 TAGAGAAAGACTACAAAAAAAGG + Intronic
1011082301 6:83502975-83502997 AAGAGAGAGAATAAAAACCAAGG - Intergenic
1011977778 6:93327367-93327389 TATAAATAGAATAAAAACCAGGG - Intronic
1012105299 6:95149735-95149757 TAGATACCTACTAAATACCAGGG - Intergenic
1012198951 6:96381101-96381123 CAAAGACAGACAAAAGACCATGG - Intergenic
1012981771 6:105838279-105838301 TAGAGGCAGAAAAAAAACCCTGG + Intergenic
1013144256 6:107372241-107372263 GAGAGAGAAACCAAAAACCAGGG - Intronic
1013944390 6:115704511-115704533 TAGAGACAAACTAAAAACTATGG + Intergenic
1015742714 6:136474327-136474349 TAGAGACTGACTAGAAGTCAGGG + Intronic
1017418660 6:154249476-154249498 TTGAGACAAACCAAGAACCAGGG + Intronic
1018186517 6:161269667-161269689 TGGAGACAGCCTCTAAACCATGG - Intronic
1019833648 7:3358974-3358996 GAAAAACAGACTAAAAACCAGGG - Intronic
1020521204 7:9189635-9189657 TAGCGAGAGACTACAAACCCGGG - Intergenic
1022197994 7:28088084-28088106 CAGAAACAGCCTGAAAACCAGGG + Intronic
1022405351 7:30084892-30084914 TAGAGCCAGGCTACAAACCCAGG + Intronic
1022408136 7:30111959-30111981 TCTAGAAAGACTAAAAACAATGG + Intronic
1022435839 7:30384153-30384175 GAGACAGAAACTAAAAACCATGG + Intronic
1022627173 7:32049442-32049464 TAGACAGAAACTAAAAATCATGG - Intronic
1023218421 7:37891731-37891753 GAGACAGAAACTAAAAACCATGG + Intronic
1024035553 7:45504960-45504982 TGGAAACAGACAAAAAACCAAGG + Intergenic
1024717857 7:52101068-52101090 TAGAGACAGACTCAAATGCTGGG - Intergenic
1024924395 7:54598067-54598089 GAGACAGAAACTAAAAACCATGG + Intergenic
1026824811 7:73574862-73574884 TAGAGACAGAATCCAAACCCAGG - Intronic
1027850818 7:83449552-83449574 CAGAGACAAAATAAAAACCCAGG + Intronic
1029630478 7:101747260-101747282 GAGACAGAAACTAAAAACCATGG + Intergenic
1029862780 7:103591967-103591989 TAGAGGGAGACCAAAAATCAGGG - Intronic
1029891541 7:103935152-103935174 TACAGACCAACTAAAAACCTAGG - Intronic
1030237214 7:107277393-107277415 GAGATAGAAACTAAAAACCATGG + Intronic
1033053255 7:138026351-138026373 TGGAGACAGAAGAAAAACAAAGG - Intronic
1033832478 7:145270506-145270528 TAGATACAGTCTGAACACCAAGG + Intergenic
1034480800 7:151319199-151319221 GAGACAGAAACTAAAAACCATGG + Intergenic
1034540858 7:151757023-151757045 TAGAGCAAGACCAAAAACCGGGG - Intronic
1034711282 7:153193398-153193420 TAGAGACAGACATTAGACCAAGG - Intergenic
1036135250 8:6154181-6154203 TAGATACAGAATTAAAACCTTGG + Intergenic
1037654397 8:20870713-20870735 TTGTGGCAGACTGAAAACCATGG - Intergenic
1038510478 8:28129834-28129856 TAGAGAAAGACTGAAAATGAGGG - Intronic
1038826200 8:31005071-31005093 TACTGACAGACTCAAAAACATGG + Intronic
1039189786 8:34960237-34960259 TAGGAACAGACTAAAGACAACGG + Intergenic
1039376783 8:37042565-37042587 TGGTGCCAGAATAAAAACCAAGG - Intergenic
1040627413 8:49165513-49165535 TATAATCAGACTAAAAACAATGG - Intergenic
1040753770 8:50744692-50744714 TAGAGACAGACATAAAAACATGG + Intronic
1040867014 8:52058185-52058207 CACAAACAGACTAAAAGCCAAGG - Intergenic
1041053085 8:53956376-53956398 TATAAACAGGCTAAAATCCAAGG - Intronic
1041184125 8:55281139-55281161 GAGGGAAAGACTAAAACCCAAGG - Intronic
1041572508 8:59353216-59353238 AAGACAGAAACTAAAAACCATGG - Intergenic
1041697452 8:60751195-60751217 TAGAGACAGGCAAAAAGCTAGGG - Intronic
1041978538 8:63828252-63828274 AAGACAGAAACTAAAAACCATGG - Intergenic
1043072152 8:75651738-75651760 TAGAGACAGATTTAAGACTAAGG + Intergenic
1044170240 8:89042481-89042503 GAGACAGAAACTAAAAACCAAGG - Intergenic
1045045592 8:98273320-98273342 TAGAGACAGAAAATAAATCAGGG + Intronic
1046493842 8:114987424-114987446 AATAGAAAAACTAAAAACCAAGG + Intergenic
1047873235 8:129107683-129107705 TGGAGACAAACTGTAAACCAGGG - Intergenic
1048262794 8:132959888-132959910 AAGACAGAAACTAAAAACCATGG - Intronic
1048486844 8:134856277-134856299 AACAGACAGACAAAAAAGCAGGG - Intergenic
1048841126 8:138567270-138567292 TAGGAACAGATTAAAAATCATGG - Intergenic
1048882476 8:138882163-138882185 TAGAGACAGGCTCACAACCCAGG + Intronic
1049602594 8:143514850-143514872 AAGAAACAGACAAAGAACCAAGG - Intronic
1050566700 9:6891465-6891487 TAGAGACAGAAGATAAATCAGGG + Intronic
1050588803 9:7141280-7141302 TAGAGAGAAACTAAAAAGGATGG + Intergenic
1051370966 9:16358716-16358738 GAGACAGAAACTAAAAACCATGG + Intergenic
1051645828 9:19267469-19267491 TACACACAGACTAAAAATAAAGG - Intronic
1051781903 9:20698062-20698084 TAGAGAATGATAAAAAACCATGG + Intronic
1052287986 9:26808346-26808368 TAGAGACTCACTGAAACCCAAGG + Intergenic
1052823464 9:33158261-33158283 TAGAAAAAGAATAAAGACCAGGG + Intronic
1053608692 9:39687310-39687332 TAGACAGAAACTAAAAACCATGG + Intergenic
1053866541 9:42443668-42443690 TAGACAGAAACTAAAAACCATGG + Intergenic
1054244832 9:62655100-62655122 TAGACAGAAACTAAAAACCATGG - Intergenic
1054558958 9:66689631-66689653 TAGACAGAAACTAAAAACCATGG - Intergenic
1055078881 9:72246973-72246995 GAGACAGAAACTAAAAACCATGG + Intronic
1056184131 9:84116129-84116151 TACACACAGACTAAAAATAATGG - Intergenic
1056701764 9:88917152-88917174 GAGACAGAAACTAAAAACCATGG + Intergenic
1057118421 9:92547747-92547769 TAGGAATATACTAAAAACCATGG + Intronic
1057637398 9:96782737-96782759 TAAAGACAGACTAATACACAGGG - Intergenic
1060278589 9:122200539-122200561 GAGACAGAAACTAAAAACCATGG + Intergenic
1060373874 9:123101243-123101265 TGGAGACAGGCAAAAAAGCAGGG - Intronic
1061738815 9:132684087-132684109 CAGAGACAGGACAAAAACCAGGG - Intronic
1061947522 9:133917054-133917076 TAGAGAAAGAGGAAAACCCAGGG - Intronic
1186206151 X:7203014-7203036 GAGAGACAGAGACAAAACCAGGG - Intergenic
1186291149 X:8100459-8100481 TAGAGACAGATTGAAAATAAAGG + Intergenic
1186676609 X:11823997-11824019 TAGAGCCAGAATAAGAACTATGG - Intergenic
1187049570 X:15682440-15682462 TAAAGACAAACTAAATATCAAGG - Intergenic
1188615577 X:32155150-32155172 TAGAGGCAGAATAAAAAGCTGGG - Intronic
1190262064 X:48803519-48803541 TGAAGACAGACTTAAGACCAGGG + Intronic
1192199023 X:69052293-69052315 AAGAGACAGAATCAAAAGCAGGG + Intergenic
1192688406 X:73332113-73332135 TTGACACAGAATAAAAAACATGG - Intergenic
1193077811 X:77374163-77374185 TAGAGACAGATAAAAGATCAAGG + Intergenic
1194332092 X:92595900-92595922 TAGAGACAGAAGAAAAACAAAGG - Intronic
1194523840 X:94951440-94951462 TAAAGACAGAATAAAAACAAAGG + Intergenic
1198481406 X:137044793-137044815 CAGAGGCAAACTAAAAATCAGGG - Intergenic
1200640799 Y:5714955-5714977 TAGAGACAGAAGAAAAACAAAGG - Intronic