ID: 990550748

View in Genome Browser
Species Human (GRCh38)
Location 5:56875660-56875682
Sequence AGACTAAAAACCATGGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 2, 1: 54, 2: 56, 3: 57, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990550742_990550748 10 Left 990550742 5:56875627-56875649 CCTCATCCTCCTTTTCCACTTAC 0: 1
1: 0
2: 18
3: 115
4: 1055
Right 990550748 5:56875660-56875682 AGACTAAAAACCATGGCTTCAGG 0: 2
1: 54
2: 56
3: 57
4: 230
990550744_990550748 1 Left 990550744 5:56875636-56875658 CCTTTTCCACTTACCACTAGAGA 0: 1
1: 3
2: 8
3: 16
4: 181
Right 990550748 5:56875660-56875682 AGACTAAAAACCATGGCTTCAGG 0: 2
1: 54
2: 56
3: 57
4: 230
990550741_990550748 14 Left 990550741 5:56875623-56875645 CCTTCCTCATCCTCCTTTTCCAC 0: 1
1: 4
2: 52
3: 368
4: 2181
Right 990550748 5:56875660-56875682 AGACTAAAAACCATGGCTTCAGG 0: 2
1: 54
2: 56
3: 57
4: 230
990550745_990550748 -5 Left 990550745 5:56875642-56875664 CCACTTACCACTAGAGACAGACT 0: 1
1: 0
2: 3
3: 36
4: 149
Right 990550748 5:56875660-56875682 AGACTAAAAACCATGGCTTCAGG 0: 2
1: 54
2: 56
3: 57
4: 230
990550740_990550748 25 Left 990550740 5:56875612-56875634 CCAGTAAAGCTCCTTCCTCATCC 0: 2
1: 53
2: 57
3: 64
4: 417
Right 990550748 5:56875660-56875682 AGACTAAAAACCATGGCTTCAGG 0: 2
1: 54
2: 56
3: 57
4: 230
990550743_990550748 4 Left 990550743 5:56875633-56875655 CCTCCTTTTCCACTTACCACTAG 0: 1
1: 8
2: 28
3: 53
4: 242
Right 990550748 5:56875660-56875682 AGACTAAAAACCATGGCTTCAGG 0: 2
1: 54
2: 56
3: 57
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990550748 Original CRISPR AGACTAAAAACCATGGCTTC AGG Intronic
900485088 1:2918925-2918947 AGACCAAAAACCATGGCCTCAGG - Intergenic
901602771 1:10434985-10435007 GTATTAAAAACCATGTCTTCGGG + Intronic
902311097 1:15582451-15582473 AGACTTCAAACCATGCCATCGGG + Intronic
903285393 1:22273660-22273682 AGGCCAGAACCCATGGCTTCAGG - Intergenic
903542043 1:24102023-24102045 AGACTCCATTCCATGGCTTCAGG - Intronic
904956304 1:34286906-34286928 TGACTAAAAACCATGACAGCAGG - Intergenic
905747293 1:40428945-40428967 AGAATAAAATCCATTCCTTCTGG + Intergenic
907149969 1:52275542-52275564 AGTCAAAAAACCATGGATGCTGG - Intronic
908130157 1:61067391-61067413 AGCCTAAGAACCAGGACTTCAGG - Intronic
908254180 1:62289109-62289131 AAACTAAAACCTATGTCTTCAGG - Intronic
909516818 1:76519091-76519113 AGACTTAAAAACATGCATTCTGG + Intronic
910256466 1:85253083-85253105 AAACTAAAAACCATGGCTTCAGG - Intronic
911178163 1:94838193-94838215 TGACCAGAAACCATGTCTTCTGG + Intronic
911705891 1:101012303-101012325 AAACTAAAAACCATGGCTTCAGG - Intronic
912328044 1:108787446-108787468 AAACTAAAAACCATGGCTTCAGG + Intronic
913175056 1:116265994-116266016 AAACTAAAAACCATGGCTTCAGG - Intergenic
914764712 1:150627917-150627939 AGAGAAAAAAGCAGGGCTTCTGG + Intronic
917453305 1:175165225-175165247 AGGCTCAAAACCAGGCCTTCTGG - Intronic
918301658 1:183209747-183209769 AGACTAATAACCTTGTCTTCAGG - Intronic
919217292 1:194574963-194574985 AAAGCTAAAACCATGGCTTCAGG + Intergenic
920108832 1:203573062-203573084 AGGCTCTAAACCATGGATTCTGG - Intergenic
920817478 1:209348498-209348520 AAACTAAAAGCCATGGCTTCAGG - Intergenic
921139507 1:212293026-212293048 AAACTAAAAACCATGGCTTCAGG + Intronic
923699656 1:236287812-236287834 AAACTAAAAACCATGGCTTCAGG + Intergenic
924073507 1:240308471-240308493 AAACTAAACACCATGGCTTCAGG - Intronic
924268664 1:242309278-242309300 AAATTAAAAACCATGGCCTTGGG + Intronic
1063438015 10:6050167-6050189 TGACTGAAAACCAGAGCTTCAGG + Intronic
1063624901 10:7679840-7679862 AAACTTAAAACCATGGCGGCAGG + Intergenic
1064200853 10:13283693-13283715 AGAATAAAACCCAGGGATTCCGG - Exonic
1064443594 10:15373957-15373979 AAACTGAAAACGATGGCTTTAGG - Intergenic
1065030313 10:21579500-21579522 AAAAAAAAAACCAGGGCTTCAGG - Intronic
1065538519 10:26737798-26737820 ACACATAAAACCATGGCTTCGGG - Intronic
1065912342 10:30319586-30319608 AGTATAAAAACCATGGATTTTGG + Intronic
1066156680 10:32685421-32685443 AAACTAAAAACCATGGCTTTGGG - Intronic
1066638956 10:37536428-37536450 AAACTAAAAACCATGGCTTCAGG - Intergenic
1066649457 10:37640617-37640639 GAACTAACAACCATGGGTTCAGG - Intergenic
1066687077 10:37991586-37991608 AAACTAAAAACCATGGAATCAGG - Intergenic
1066716242 10:38289490-38289512 AAATTAAAAACCATGGCTTCGGG - Intergenic
1066950370 10:42111474-42111496 GGACAAAAAGCCGTGGCTTCAGG + Intergenic
1067488904 10:46679277-46679299 AAACTAAAAACCATGGCTTCAGG + Intergenic
1067605764 10:47661099-47661121 AAACTAAAAACCATGGCTTCAGG - Intergenic
1067859232 10:49827535-49827557 AAACTAAATACCACAGCTTCAGG + Intronic
1068021165 10:51586300-51586322 AGACTAAAAATGATGGCATATGG + Intronic
1069180896 10:65357250-65357272 AAACTAAAACCCATGGTGTCAGG + Intergenic
1071621323 10:87122458-87122480 AAACTAAAAACCATGGCTTCAGG - Intronic
1071868865 10:89769371-89769393 AAACTAAAAACCATGGCTTCAGG + Intronic
1071934075 10:90507271-90507293 AAACGAAAAACCATGGCTTTAGG - Intergenic
1073027051 10:100495712-100495734 AAACCAAAAACCATGGCTTCAGG - Intronic
1075204147 10:120432222-120432244 TGAATGAAAACCATGGCTCCAGG + Intergenic
1075599774 10:123758904-123758926 AGTATCAAAACCATGGCTTTGGG + Intronic
1076459405 10:130630254-130630276 AAACTAAAAATCATGGCTTCAGG - Intergenic
1077679535 11:4225788-4225810 AGATAATAAACTATGGCTTCTGG + Intergenic
1077681952 11:4250119-4250141 AGATAATAAACTATGGCTTCTGG - Intergenic
1077688950 11:4322368-4322390 AGATAATAAACTATGGCTTCTGG + Intergenic
1077880411 11:6344900-6344922 AGACATAAAATCATGGGTTCTGG + Intergenic
1078727884 11:13948085-13948107 AAACTAAAAACCATGGCTTCAGG + Intergenic
1079249334 11:18775667-18775689 GGACTAGAGCCCATGGCTTCTGG - Intronic
1079282488 11:19099915-19099937 AAAATAAAAACTATGGCTTCAGG + Intergenic
1079294433 11:19219648-19219670 AAACTAAAAACCATAGCTTCAGG - Intergenic
1079515976 11:21269282-21269304 AGACAACAAACCATGTATTCAGG + Intronic
1079805969 11:24931563-24931585 ATATAAACAACCATGGCTTCTGG - Intronic
1081757885 11:45557505-45557527 AAAACAAAAACCATGGCCTCAGG + Intergenic
1081929597 11:46859529-46859551 GGAGGGAAAACCATGGCTTCCGG + Intronic
1082848198 11:57742925-57742947 AGGGAAGAAACCATGGCTTCAGG - Exonic
1082923411 11:58520492-58520514 AGAATAGCAGCCATGGCTTCAGG - Intergenic
1084593338 11:70103064-70103086 AGACTAAAATCCACGGAGTCGGG + Exonic
1084635497 11:70389686-70389708 AAACTCAAAACCATGGCGTTGGG + Intergenic
1084837196 11:71811490-71811512 CAGCTAAATACCATGGCTTCTGG - Intergenic
1086058406 11:82675266-82675288 AGACTAGAACCCAGGGCTCCTGG - Intergenic
1086207542 11:84277973-84277995 AGACTTGAAATCCTGGCTTCAGG + Intronic
1086394115 11:86396722-86396744 AGAAATAAAACCATGGCTCCTGG + Intronic
1087348471 11:97001090-97001112 AAACCAAAAACCACAGCTTCAGG - Intergenic
1088183207 11:107135380-107135402 ACACTAAAAACCATGGCTTCAGG + Intergenic
1089714511 11:120345133-120345155 AAACTAAAAACCATGGCTTCAGG - Intronic
1090435209 11:126681235-126681257 ACACAAAAACACATGGCTTCTGG - Intronic
1090746282 11:129707691-129707713 AAACTAAAAACCATGGTTTCAGG - Intergenic
1091356118 11:134938892-134938914 AAACTAAAAACCATGGCTTCGGG + Intergenic
1092312538 12:7374063-7374085 AAACTAATAACCATGGCTTCAGG + Intronic
1092401508 12:8182589-8182611 CAGCTAAATACCATGGCTTCTGG + Intronic
1093551156 12:20413380-20413402 AAACAAAGATCCATGGCTTCAGG - Intronic
1093569974 12:20655559-20655581 AAACTAAAAACCATGGTTTCAGG + Intronic
1095351099 12:41213589-41213611 AAACTAAAAACTATGGCTTCAGG + Intronic
1097788563 12:63788988-63789010 AAACTAAAAGCCATGGCTTCAGG - Intronic
1098203142 12:68078537-68078559 AAACTAAAAACTATGGCTTCAGG + Intergenic
1098239166 12:68448835-68448857 AAACTAAAAACTATGGCTTCAGG - Intergenic
1099146889 12:79057815-79057837 AAACCAAAAATTATGGCTTCAGG + Intronic
1099174962 12:79410472-79410494 AGACTTAAAACCATGGCTTCAGG + Intronic
1099311939 12:81037323-81037345 AAACGATAAACCATAGCTTCAGG + Intronic
1100308739 12:93375549-93375571 AGTTTAAAAATCTTGGCTTCAGG - Intergenic
1100831420 12:98519498-98519520 ACTCTAAAAAACATGACTTCTGG - Intronic
1101270605 12:103140058-103140080 GAACTAAAAACCAGGGCCTCAGG + Intergenic
1101676381 12:106920891-106920913 AAACAAAAAACCATGGTTTCAGG - Intergenic
1102659399 12:114512823-114512845 GGACTAAAAACCAGGTCTCCAGG - Intergenic
1103098244 12:118149155-118149177 AAACCAAAAACCATAGCTTCAGG + Intergenic
1104513202 12:129400422-129400444 AAACTAAAAACCATGGCTTCAGG - Intronic
1105465709 13:20637689-20637711 AGACTAAAGGCCACTGCTTCAGG + Intronic
1106912097 13:34473641-34473663 AGATTAAATACTGTGGCTTCTGG + Intergenic
1107238249 13:38198939-38198961 AGAAAAAAAACCACTGCTTCTGG - Intergenic
1107303109 13:38986855-38986877 AGACTAAATACCAGAGCTTCTGG + Intronic
1110622839 13:77618260-77618282 AGACTCAAAATCCTGGGTTCAGG + Intronic
1113026225 13:105944334-105944356 AGAATAAAAACAATGGCACCTGG - Intergenic
1113749096 13:112766275-112766297 AAATGAAAAACCATGGCTTCAGG - Intronic
1114863938 14:26564081-26564103 ACACTAAAGACCATGGGTTCTGG - Intronic
1115168923 14:30480790-30480812 AGAGGAAGAACAATGGCTTCAGG + Intergenic
1115372635 14:32635313-32635335 AGAGTAAAAATCCTTGCTTCAGG + Intronic
1115374726 14:32661663-32661685 AGACTGGAAATCATGGTTTCAGG + Intronic
1116213404 14:41977281-41977303 AGAATAAAAAACAGGACTTCAGG + Intergenic
1117102433 14:52364160-52364182 AAACTAAAAACCATGGCTTCAGG + Intergenic
1117771577 14:59138989-59139011 TGACAAGAAACCATGGCTTAAGG - Intergenic
1117895186 14:60477036-60477058 AGATTAAAAATCAAGGCTGCAGG - Intronic
1118458876 14:65970042-65970064 AGACAAATTACCATGGCCTCAGG + Intronic
1118599905 14:67464667-67464689 AGACTAAATAGCATCTCTTCTGG + Intronic
1118872011 14:69750928-69750950 AAACTAAAAACCCTGGCTTCAGG + Intronic
1119606646 14:76024021-76024043 AAACTAAAAACTACGGGTTCAGG + Intronic
1120538569 14:85727386-85727408 AGACTAAAATTCAAGGGTTCTGG + Intergenic
1122295643 14:100704253-100704275 AGACTAAAACCCACAGCTGCAGG - Intergenic
1122491338 14:102117841-102117863 AGACTCAAAACCCTGGCTCAGGG - Intronic
1123460904 15:20470305-20470327 AGACTCAAAACAATCTCTTCTGG + Intergenic
1123657157 15:22530109-22530131 AGACTCAAAACAATCTCTTCTGG - Intergenic
1123773183 15:23549563-23549585 AAACTAAAAACTGTGGCTTCAGG + Intergenic
1124245015 15:28061367-28061389 AGACTCAAAAACATGAGTTCAGG + Intronic
1124311069 15:28625319-28625341 AGACTCAAAACAATCTCTTCTGG - Intergenic
1125426818 15:39557020-39557042 AAACTAAAAGCCATGGCTTCAGG + Intergenic
1126573649 15:50177320-50177342 AGACTCAAAATCAGGTCTTCTGG + Intronic
1126917799 15:53484775-53484797 AAACTAAAAGCCATGGCTTTAGG + Intergenic
1127343897 15:58074632-58074654 AGACAAAAAAACATGGCACCTGG + Intronic
1127479955 15:59369425-59369447 AGACTGAAACCCATGGCTGTAGG - Intronic
1129862088 15:78870980-78871002 AAACTAAAAACCATGGCTTCAGG + Intronic
1131024731 15:89130558-89130580 AAACTACAAACCATGGCTTTAGG + Intronic
1131808632 15:96149342-96149364 AGGCTACAGACCATGGCCTCTGG + Intergenic
1134019876 16:10914111-10914133 AGACGAAAATCCCTGCCTTCTGG - Intronic
1134814004 16:17191068-17191090 AAACTAAAAACCATGGCTTCAGG - Intronic
1135002348 16:18787349-18787371 AAACTAAGTACCATGGTTTCAGG + Intronic
1135425557 16:22332518-22332540 AAACTAAAAACCATGGCTTCAGG + Intronic
1138367616 16:56494266-56494288 ACATTGAAAATCATGGCTTCAGG - Intronic
1138764790 16:59589150-59589172 ATACTAACCACCATTGCTTCTGG - Intergenic
1139204048 16:65008663-65008685 AGATTTGAACCCATGGCTTCAGG + Intronic
1140489372 16:75321580-75321602 AAACTGAAAAACATGGCTTCAGG - Intronic
1140531611 16:75671545-75671567 AGACTAAAAGCCATGCTCTCTGG - Intronic
1140937602 16:79689122-79689144 AAACTAAAATCCGTGGCTTCAGG - Intergenic
1141214873 16:82013947-82013969 TGATTAAAAGCCAAGGCTTCTGG + Intergenic
1143970726 17:10793371-10793393 AAACAAAAAATGATGGCTTCAGG + Intergenic
1144083171 17:11783164-11783186 AAACTAAAAACCATGGTTTCAGG - Intronic
1144238087 17:13282185-13282207 AGACAAAAACCCAAGTCTTCTGG - Intergenic
1144592048 17:16532579-16532601 AAACTAAAAACCGTGGCTTCAGG - Intergenic
1144819592 17:18062709-18062731 AGCCTAAAAATCGTGGCTACAGG - Intronic
1147840408 17:43367581-43367603 AGACTAAACAACGTCGCTTCTGG + Intergenic
1148136434 17:45295195-45295217 AGGCTAGAACCCATAGCTTCTGG - Intronic
1150508245 17:65720969-65720991 AAACTTAAAAGCATGGATTCTGG - Intronic
1150520081 17:65857213-65857235 AACTTTAAAACCATGGCTTCTGG + Intronic
1150585061 17:66510043-66510065 AAACTAAAAAACATGGCTTCAGG - Intronic
1150919547 17:69468779-69468801 AAACTAAAAACCATGATTTCAGG + Intronic
1150998669 17:70348830-70348852 AAACTAAACACCATGGCTTTAGG + Intergenic
1152719614 17:81916800-81916822 AGACTAAACCCCAGGGCTCCGGG + Intronic
1153033074 18:733481-733503 AACCTAAAAAGCATGGCTTTCGG + Intronic
1153356982 18:4148090-4148112 AAACTAAAAGCCATGGCTTCAGG + Intronic
1154498498 18:14980412-14980434 AAACTAAAAACTGTGGCTTTGGG - Intergenic
1154994501 18:21626890-21626912 AGCCTCAAACCCCTGGCTTCAGG + Intronic
1155014901 18:21825089-21825111 AGACTAAAAACCTTTGATTCAGG + Intronic
1155300362 18:24423648-24423670 AGAAAGAAATCCATGGCTTCTGG - Intergenic
1156272268 18:35546746-35546768 AAACTAAAAACCATGGCTTCAGG - Intergenic
1156587298 18:38445407-38445429 AGACTAAAATCCAAAGCCTCTGG - Intergenic
1157467444 18:47959340-47959362 AGAACACAAACCTTGGCTTCTGG + Intergenic
1157526995 18:48391140-48391162 AGAAGTAAAACCATGGCATCTGG + Intronic
1157795367 18:50569658-50569680 AAACTAAAAACCATGGCTTCAGG + Intronic
1157927451 18:51781777-51781799 AAACTAAAAACCATGGCTTTAGG - Intergenic
1158432999 18:57408351-57408373 GGGTTAAAAACCATGGCTACAGG + Intergenic
1158927316 18:62281054-62281076 AAACTAAAAACCCCGGCTTCAGG + Intronic
1159336950 18:67080774-67080796 AAACTAAAACAGATGGCTTCGGG - Intergenic
1159469428 18:68832539-68832561 AAGCTAAAAACCAAGGTTTCCGG - Intronic
1159886275 18:73910520-73910542 AGACAAACAACAATGGCCTCAGG - Intergenic
1159886530 18:73912927-73912949 AGACAAACAACAATGGCCTCGGG - Intergenic
1160234036 18:77071473-77071495 AAACTAAAAACCATGGCTTCAGG - Intronic
1160590251 18:79940619-79940641 AGACTGAAAGCTCTGGCTTCTGG - Intronic
1160604100 18:80036042-80036064 AGATTAGAAACCATGGGTGCTGG + Intronic
1162122721 19:8481687-8481709 AACTTAAAAACCATGGTTTCAGG + Intronic
1162171758 19:8795290-8795312 AAACTAGAAACCATGGATTCAGG + Intergenic
1162293506 19:9796668-9796690 AAACTAAAAACCATGGCTTCAGG - Intergenic
1162996241 19:14337514-14337536 AGACACAAAGCCGTGGCTTCTGG - Intergenic
1164697318 19:30255429-30255451 AGACTAAAGAACACGGGTTCGGG + Intronic
1164914382 19:32038880-32038902 ATGCTAAAAACCATTGCTTCAGG - Intergenic
1164951257 19:32338900-32338922 AGACTTACAATCATGGCATCAGG - Intergenic
1166158722 19:40935800-40935822 AATCTGAAAACCATGGCTTCAGG - Intergenic
1166167650 19:41003704-41003726 AAACTGAAAACCATGGCTTCAGG - Intronic
1167461698 19:49628155-49628177 AAACTAAAAACCATGGCTTCAGG + Intergenic
1168399758 19:56078590-56078612 AAACTAAAATCCATGATTTCAGG + Intergenic
1168566313 19:57427144-57427166 AGAAACAAAACCATGGCTTCAGG - Intronic
925804557 2:7635349-7635371 GGATTAAAAGACATGGCTTCTGG + Intergenic
927369226 2:22335466-22335488 AGACAAATAACCCTGCCTTCAGG + Intergenic
929284586 2:40121046-40121068 AAACTAAAAACCATGGCTTCAGG - Intronic
930112321 2:47689111-47689133 AAACTAAAAACCATGGCTTCAGG - Intergenic
930735678 2:54776169-54776191 AAACTAAAAAACATGGCTTTGGG - Intronic
931702417 2:64919625-64919647 AGACTTAAAACATTAGCTTCTGG - Intergenic
933262151 2:80142718-80142740 AAACTAAAAACCATGGCTTTGGG - Intronic
933367638 2:81374220-81374242 AGACTAAAAACCTTGCCCTAAGG + Intergenic
934987289 2:98896785-98896807 AAACTAAAAACCATGGCTTCAGG - Intronic
935609624 2:105007769-105007791 AAACTAAAAACCATGGCTTCAGG - Intergenic
936749966 2:115630078-115630100 AAACTACAAACCATGGCTCAAGG - Intronic
936953507 2:118001939-118001961 AGGCTACATACCATGGCTTTGGG - Intronic
939423270 2:142001238-142001260 AGAATAAAAACCATGGCTTTTGG - Intronic
941406679 2:165098611-165098633 AAACTAAAAACCATGGCTTCAGG + Intronic
941478910 2:165982117-165982139 AAACTAAAAGTCATGGCTTCAGG - Intergenic
942895767 2:181052375-181052397 AAACTAAAACCCATGGCTTTAGG + Intronic
943174281 2:184449709-184449731 ATACTCAAATCCATAGCTTCAGG + Intergenic
943576112 2:189632834-189632856 AGACTCAGAGCCATGGCTTTAGG - Intergenic
943650150 2:190449108-190449130 TGTATAACAACCATGGCTTCAGG + Intronic
944024435 2:195146205-195146227 AAACTTAAAACCATGGCTGAAGG - Intergenic
944239518 2:197472393-197472415 AAACTAAAACCCATGGCTTCAGG + Intronic
944322800 2:198367439-198367461 AGACTAAAAACAATAGCTGTAGG + Intronic
944816114 2:203377446-203377468 AGAATAAAAACAATGTCTTGAGG + Intronic
945039068 2:205729248-205729270 CATCTGAAAACCATGGCTTCTGG + Intronic
947154614 2:227149460-227149482 AAACTAAAAATCATGGTTTCAGG + Intronic
947174405 2:227348634-227348656 AGAACAAAAAGCATGGATTCAGG + Intronic
947361301 2:229348174-229348196 GGACTAAAAACAATGGAGTCAGG - Intergenic
947462912 2:230318609-230318631 AGTCAAAAAACAATGGCTTGAGG + Intergenic
948245109 2:236475691-236475713 AGACAAAAAATAATGGATTCCGG - Intronic
1169799556 20:9500859-9500881 AGGATAAAATCCATGTCTTCAGG - Intergenic
1172736350 20:37128748-37128770 AAACTAAATACCATGGCTTCAGG + Intronic
1173037249 20:39424338-39424360 AAACTAAAAACCATGGCTTCAGG - Intergenic
1173309936 20:41888442-41888464 AGCCTAAGAACCCTGGCTACAGG + Intergenic
1173909436 20:46653470-46653492 AAACTAAAAACCATGGCTTCAGG + Intronic
1174236073 20:49093157-49093179 AGACCAGAAAACATGGCTTCCGG + Intronic
1174432404 20:50479755-50479777 ACAGTAACTACCATGGCTTCTGG + Intergenic
1174710153 20:52695842-52695864 AGGCTGAAAACCTTGGCATCCGG - Intergenic
1174914920 20:54644145-54644167 AGGCCAGAAGCCATGGCTTCAGG + Intronic
1177489953 21:21810075-21810097 AAAATAAAAACAATGTCTTCAGG - Intergenic
1177973477 21:27819240-27819262 AGATTAGAACCCAGGGCTTCTGG - Intergenic
1179075584 21:38118347-38118369 AGCAGAAAAACCATGTCTTCAGG + Intronic
1179436743 21:41367643-41367665 AGACTAAGAAGCATGCATTCTGG - Intronic
1179440015 21:41386948-41386970 AAACCAAAAACCATGGCTTCAGG + Intronic
950358829 3:12435851-12435873 AAATTAAAAACCATGGCTTCAGG + Intergenic
951398762 3:22203852-22203874 CAACTTCAAACCATGGCTTCTGG + Intronic
951990141 3:28667617-28667639 AAACTAAAAACAATGGCTACAGG + Intergenic
952064493 3:29552131-29552153 ATACAACAAACCATGGCTTTTGG + Intronic
952098944 3:29989068-29989090 AGACTAGAAACCATTGCTCTAGG + Intronic
952606153 3:35149164-35149186 AAACTAAAAATTGTGGCTTCAGG + Intergenic
952798341 3:37263350-37263372 AAACTAAAAACCATGCCTTTAGG - Intronic
955191414 3:56765256-56765278 AAACTAAAAACCATGGCTTCAGG - Intronic
955990215 3:64618833-64618855 ACACAAAAACTCATGGCTTCGGG + Intronic
956083268 3:65582160-65582182 AGCCTAAAATCCTTGCCTTCAGG - Intronic
957190666 3:77005005-77005027 AAACGAAAAACCATGGCTTCGGG + Intronic
957262432 3:77919628-77919650 AGAGTGAATACCATGGCTGCTGG + Intergenic
957281784 3:78160225-78160247 AAACCAAAAAAAATGGCTTCAGG - Intergenic
957527320 3:81393835-81393857 TGAATAAAAACCATGCTTTCAGG - Intergenic
957561448 3:81826932-81826954 AGACAAAAAATAATGGGTTCTGG - Intergenic
957944372 3:87043892-87043914 AAACTAAAAACAATGGCTTCAGG - Intergenic
959015827 3:101132925-101132947 AAGCTAAAAACCATGGCTTCAGG + Intergenic
959550618 3:107651897-107651919 AAACTAAAAACCATGGCTACAGG - Intronic
959817247 3:110688911-110688933 AGACTAGAACCCACGGATTCTGG + Intergenic
960028486 3:113034438-113034460 AGAGTAAAAAGCATGGTGTCTGG + Intergenic
960733079 3:120747194-120747216 AAAATAAAAACCTGGGCTTCGGG - Intronic
960811345 3:121630481-121630503 AAACTAAAAACCATGGCTTCAGG - Intergenic
962339074 3:134566436-134566458 AGATTAAAAACCATAGCTTTAGG + Intronic
965128893 3:164669176-164669198 AAACTACAAACCATGGCTCAAGG + Intergenic
965219643 3:165912230-165912252 AAACCAAAAATCTTGGCTTCTGG - Intergenic
967540534 3:190662084-190662106 ATAATAATAACCATAGCTTCTGG + Intergenic
967562297 3:190930750-190930772 AAGCTAAAAACCATGACTTTTGG - Intergenic
968507989 4:980798-980820 AAACTAAAAACCAGGGTTTAGGG + Intronic
969762773 4:9201669-9201691 TAACTGAATACCATGGCTTCTGG - Intergenic
969778604 4:9378982-9379004 CAGCTAAATACCATGGCTTCTGG - Intergenic
970761237 4:19490812-19490834 AAAATAAAAACCATAGCTTCAGG + Intergenic
971435134 4:26613379-26613401 AAACCAAAAACCATGGCTTCAGG - Intronic
973687438 4:53386855-53386877 AAACTAAAAACCATGGCTTTGGG - Intronic
973949334 4:55995353-55995375 AGACTAAAAACCATGGCTTCAGG - Intronic
974858860 4:67495486-67495508 AAACTAAAAAGCATGGTTTCAGG - Intronic
975606840 4:76163571-76163593 AGAGTAAAAAAAATGTCTTCAGG - Intronic
975912339 4:79281837-79281859 AAACTAAACACCATGGCTGCAGG + Intronic
976067676 4:81207848-81207870 AGACTTGAAACCTTGGCTTCAGG - Intronic
976756668 4:88505980-88506002 AAATGAAAAACCATGGCTTCAGG - Exonic
977282117 4:95053389-95053411 AGATTAAAAACCAGGCATTCTGG - Intronic
978732701 4:112048982-112049004 AGACTTAAAACAAGTGCTTCAGG + Intergenic
979312157 4:119215725-119215747 AGGCTACAAACCATTGCATCTGG + Intronic
979579222 4:122336260-122336282 GGACTAATAACCATTTCTTCTGG - Exonic
980843725 4:138298901-138298923 AGAGTAAGAACAATGGCTTCAGG - Intergenic
981499074 4:145428067-145428089 AAACAGAAAACCATGGCTTCAGG - Intergenic
981867294 4:149438250-149438272 AGGCTAAAAACAATGGCAACAGG + Intergenic
984331178 4:178321097-178321119 AAACTAAAAACCATGGCTTCAGG - Intergenic
984439839 4:179752983-179753005 AGACTAATAATACTGGCTTCTGG - Intergenic
984968497 4:185164637-185164659 AAACTAAAAACCATGGCTTCAGG + Intronic
985284681 4:188323273-188323295 AGACAAAAAACCAATGCTGCTGG + Intergenic
985763104 5:1761732-1761754 ACACTAAAAGCCATTGCCTCTGG - Intergenic
985940471 5:3131858-3131880 AGACAACAAACCTTGGCTGCAGG + Intergenic
987903094 5:24038871-24038893 AAACTACAAACCATGGCTCATGG - Intronic
989059391 5:37395373-37395395 AAACTAAAAACCACGGCTTCAGG - Intronic
989306326 5:39960859-39960881 AGTGTTAAATCCATGGCTTCTGG - Intergenic
989795481 5:45465805-45465827 AGACTACAAACAATGTCTTTAGG + Intronic
990550748 5:56875660-56875682 AGACTAAAAACCATGGCTTCAGG + Intronic
990805454 5:59655640-59655662 AAGCTAAAAACCATGGCTTCTGG - Intronic
990973110 5:61531323-61531345 AGCCTAAAAAACATGTTTTCTGG + Intronic
991261885 5:64676731-64676753 AAACTAAAAACCATGGCTTCAGG + Intergenic
991451615 5:66756948-66756970 TGATTAAAAACCTTGGCTTGTGG + Intronic
992422648 5:76622011-76622033 AAACTAAAAACCATGGCTTCAGG + Intronic
995303361 5:110612238-110612260 AGACTAAAATTCATGTCTTCTGG + Intronic
995346917 5:111132223-111132245 AGACTAAAAACCCTCCCTTCTGG + Intergenic
995394877 5:111676871-111676893 AGATTAAAAACCAAGACTTTTGG + Intronic
997780946 5:136657885-136657907 AGACAAAAATCCAAGGCTTAGGG + Intergenic
997970136 5:138394697-138394719 AGAGTAAAAACCAAGGCCTTTGG - Intronic
999559038 5:152779289-152779311 AGAGTAATAAACAAGGCTTCTGG + Intergenic
999651216 5:153769369-153769391 AGTCTAAAAACCATTGCCTTTGG + Intronic
1000369977 5:160525810-160525832 AGACTATAAACCTTGCCATCAGG + Intergenic
1001318027 5:170658096-170658118 AGACCAAAAACAATGGCATGGGG + Intronic
1001817080 5:174678653-174678675 AAACTAAAAACCATGGCTTCAGG - Intergenic
1002450395 5:179315226-179315248 AGATTAAATACCCTGGCTTCTGG + Intronic
1003253060 6:4449404-4449426 AAACTAAAAACCAAGGCGTCAGG - Intergenic
1003500374 6:6698037-6698059 AGGTTAAGAACTATGGCTTCAGG + Intergenic
1005974236 6:30785154-30785176 ATACTAAAAACCATTTCTGCCGG - Intergenic
1007490920 6:42221212-42221234 AGGATAAAATCCATGTCTTCTGG - Intergenic
1008554691 6:52663560-52663582 AAACTAAAAACCACGGCTTCAGG - Intergenic
1008793253 6:55265988-55266010 AAACTAAAAACCAGGGCTTCAGG + Intronic
1009192955 6:60651665-60651687 AAACTAAAAACTGTGGCTTCAGG - Intergenic
1010627664 6:78158223-78158245 AAACTAAAACCCATGGCTTCAGG - Intergenic
1012819631 6:104069716-104069738 AAACTAGAAACCATGGCTTTAGG - Intergenic
1013986894 6:116205175-116205197 AAACTAAAAACCATGTCTTCAGG + Intronic
1014992255 6:128095453-128095475 AAACTAAAAACCATGGCTTCAGG - Intronic
1015335105 6:132027963-132027985 AAACTAAAATCCATGGCTTCAGG - Intergenic
1015800387 6:137055264-137055286 AAACTAAAAACCATTGCTGAAGG + Intergenic
1020974396 7:14987545-14987567 AAACTAAAAACCATGACTTCAGG - Intergenic
1022435840 7:30384160-30384182 AAACTAAAAACCATGGCTTCAGG + Intronic
1022627172 7:32049435-32049457 AAACTAAAAATCATGGCTTCAGG - Intronic
1022728244 7:32999725-32999747 AGACAAAAAACCCTGGCTTTTGG - Intronic
1022816877 7:33922530-33922552 AAACTAAAAACCATGACTTCAGG - Intronic
1023218423 7:37891738-37891760 AAACTAAAAACCATGGTTTTGGG + Intronic
1023706372 7:42945909-42945931 AAAGTGAAAACCATGACTTCAGG - Intronic
1023740547 7:43277409-43277431 AAACGAAAAACCATGGCTTCAGG - Intronic
1024806516 7:53147854-53147876 AAGCTAAAAACCATGTCTGCAGG + Intergenic
1024924396 7:54598074-54598096 AAACTAAAAACCATGGCTTCAGG + Intergenic
1025045410 7:55688293-55688315 AAACAAAAAACCCTGGCTTTTGG + Intergenic
1025121366 7:56306802-56306824 AAACTAAAAATCATGGCTTCAGG - Intergenic
1026497028 7:70912258-70912280 AGAGTAAAGACCATGGTTTAGGG + Intergenic
1026793507 7:73350636-73350658 AGACTAAAAACAATGTTTTCTGG + Intronic
1027954920 7:84865572-84865594 AAACTAAAAATCATAGCTTTGGG - Intergenic
1028114260 7:86979934-86979956 AAACTAAAAATCATGGTTTCAGG + Intronic
1028862524 7:95669559-95669581 AGACTATAAAATATGGGTTCTGG + Intergenic
1029630479 7:101747267-101747289 AAACTAAAAACCATGGTTTCAGG + Intergenic
1030237215 7:107277400-107277422 AAACTAAAAACCATGGCTTCAGG + Intronic
1030289970 7:107862546-107862568 AAACTCAAAATCATGGATTCAGG - Intergenic
1031989546 7:128188760-128188782 AGGTTAAAAACCATGGCTTTAGG + Intergenic
1032495964 7:132362717-132362739 AGACTATAAACCATGACTTTGGG + Intronic
1032578284 7:133078941-133078963 AAGCTAAAAACAATGGCTTATGG + Intronic
1032994661 7:137431806-137431828 TGACTCCAAACCATGGCTTTTGG + Intronic
1033683400 7:143618682-143618704 AAACTAAAAACCGTGAGTTCAGG - Intergenic
1033701213 7:143838956-143838978 AAACTAAAAACCGTGAGTTCAGG + Intergenic
1034480801 7:151319206-151319228 AAACTAAAAACCATGGCTTCAGG + Intergenic
1036038926 8:5052611-5052633 AGAATAGAAACCACGTCTTCTGG - Intergenic
1036276049 8:7352955-7352977 CAGCTAAATACCATGGCTTCTGG - Intergenic
1036840630 8:12118159-12118181 CAGCTAAATACCATGGCTTCTGG + Intergenic
1037329413 8:17729273-17729295 ATACTCAAAACCGTGGCTGCAGG + Intronic
1038523068 8:28249854-28249876 AGACTGCTCACCATGGCTTCAGG + Intergenic
1038626429 8:29197715-29197737 AAACTAAAGACCATGGCTTCAGG + Intronic
1039600524 8:38833204-38833226 AAACTAAAAACTATGGCTTCAGG - Intronic
1040758733 8:50812262-50812284 AGACTGGAAACAATAGCTTCAGG - Intergenic
1040838161 8:51754419-51754441 AGGGGAAAAGCCATGGCTTCTGG + Intronic
1041572506 8:59353209-59353231 AAACTAAAAACCATGGCTTCGGG - Intergenic
1041978537 8:63828245-63828267 AAACTAAAAACCATGGCATCAGG - Intergenic
1042199231 8:66264306-66264328 AAACTGAAAACCATGGTTTCAGG - Intergenic
1042708769 8:71691533-71691555 AAACTAAAAATCTTGGCTTGAGG + Intergenic
1043379562 8:79688035-79688057 AAACTATAAACCATGGCTTCAGG + Intergenic
1043663257 8:82773813-82773835 AGACTAAAGACTATGGTTGCTGG - Intergenic
1044170239 8:89042474-89042496 AAACTAAAAACCAAGGCTTCAGG - Intergenic
1044838394 8:96317154-96317176 AGACTAAAAGCCAAGCCTACGGG + Intronic
1045099461 8:98829796-98829818 AGACAAAAATCCCTGCCTTCAGG + Intronic
1047393378 8:124472548-124472570 AAACTAAAAACCATGGCTTCAGG + Intergenic
1048862026 8:138730631-138730653 TGTATAAAAACCATGGCTTCCGG + Intronic
1049664806 8:143838175-143838197 AGACTTAACTCCATGGCCTCAGG - Intronic
1049945720 9:593532-593554 AGCCAAAAAACAAAGGCTTCAGG - Intronic
1050588804 9:7141287-7141309 AAACTAAAAAGGATGGCTTCAGG + Intergenic
1051370967 9:16358723-16358745 AAACTAAAAACCATGGCTTCAGG + Intergenic
1052767617 9:32657674-32657696 AGACTGCAAACCTTGGCCTCTGG - Intergenic
1053005074 9:34598979-34599001 AGACCAAAAACCAGGGCTCAGGG - Intergenic
1053428634 9:38027459-38027481 AGACTAAAAGGCATGGCCTGTGG - Intronic
1053608693 9:39687317-39687339 AAACTAAAAACCATGGCTTCAGG + Intergenic
1053866542 9:42443675-42443697 AAACTAAAAACCATGGCTTCAGG + Intergenic
1054244831 9:62655093-62655115 AAACTAAAAACCATGGCTTCAGG - Intergenic
1054558957 9:66689624-66689646 AAACTAAAAACCATGGCTTCAGG - Intergenic
1054936260 9:70691969-70691991 AAACTAAAATCCATGGCTTTAGG + Intronic
1055078882 9:72246980-72247002 AAACTAAAAACCATGGCTTCAGG + Intronic
1056082972 9:83116046-83116068 AGATTTGAAACCATGGCTACAGG + Intergenic
1058502828 9:105638832-105638854 AGAATAAAAACAATGGTTTGAGG - Exonic
1058624768 9:106923664-106923686 ATATTAAGAACCATGGCTACAGG - Intronic
1060278590 9:122200546-122200568 AAACTAAAAACCATGGCTTCAGG + Intergenic
1060308968 9:122442227-122442249 TGACTAAATACCATTGCCTCTGG + Intergenic
1060433741 9:123574732-123574754 AAACTAAAAGCTATGGCTTTGGG + Intronic
1060536539 9:124393746-124393768 AGACTAACAATCACGGCATCAGG + Intronic
1185735730 X:2494368-2494390 AGAATAAAAACCTTTGCTCCAGG - Intronic
1185913537 X:4008978-4009000 AAACTAAAATCCATGGCTTCAGG - Intergenic
1186566735 X:10671258-10671280 AGAATTAAAACCATGGATTCTGG + Intronic
1186708893 X:12172220-12172242 AAACTAAAAATCATGGCTTCAGG - Intronic
1186810014 X:13179119-13179141 AGACTAAAAGCTGAGGCTTCAGG - Intergenic
1186912102 X:14179133-14179155 AGATTAAAATCCAGGGCTTTAGG - Intergenic
1186990112 X:15057960-15057982 AGGTTAAAAACCTTGGCTTTGGG - Intergenic
1187266865 X:17741696-17741718 AAACTAAAAAGCATAGCTTCAGG - Intronic
1189141968 X:38616572-38616594 AACTTAAAAACCATGGCTTCAGG + Intronic
1190716848 X:53111784-53111806 AAACTAAAAACCGTGGCTTCAGG + Intergenic
1192808198 X:74528293-74528315 AGACTGAAGACCTGGGCTTCAGG - Intronic
1196397503 X:115280839-115280861 AAACTAAAAACTATGTCTTGAGG - Intergenic
1197810410 X:130436787-130436809 ACACTAACATTCATGGCTTCTGG + Intergenic
1198781887 X:140246831-140246853 AGACTACAAACTAGGTCTTCTGG + Intergenic
1199443424 X:147895025-147895047 AGACTTAAAATCTTGGCTTGAGG - Intergenic
1199713124 X:150486346-150486368 AGACTAAAAAGCATGAAATCTGG - Intronic