ID: 990551703

View in Genome Browser
Species Human (GRCh38)
Location 5:56887437-56887459
Sequence GCAGCCAGGTTGGCATCAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990551703 Original CRISPR GCAGCCAGGTTGGCATCAAA AGG Exonic
900732389 1:4270860-4270882 GCAGCCAAGTTGTCAGCACAGGG - Intergenic
902619388 1:17642146-17642168 GCAGGCAGGTGGACATTAAATGG + Intronic
903805981 1:26005955-26005977 GCAGAGAGGTTGGCAGCAGATGG + Intergenic
904010939 1:27390262-27390284 GCTGGGAGGTTGGCATCAAAGGG - Intergenic
904992265 1:34602590-34602612 GCAGCCAGGGTGACTTCAAGTGG + Intergenic
915914611 1:159933507-159933529 AAAGACAGGTTAGCATCAAAAGG - Intronic
920860024 1:209698408-209698430 CCAGCCAGGTGGGCATCTCAAGG - Intronic
923452524 1:234132448-234132470 GCGGCCAAGTTTGCATCCAAAGG + Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924418732 1:243887150-243887172 TAAGCCAGGTTGGCATTAAAAGG + Intergenic
924574358 1:245266246-245266268 CCAGTCTGGTTGGTATCAAATGG - Intronic
1064009933 10:11727649-11727671 GCAGCAAGGCAGGCATCAATGGG + Intergenic
1066262139 10:33739278-33739300 GCAGCCACCTTGGCATCATGAGG - Intergenic
1067085016 10:43233588-43233610 GCAGCAAGGCTACCATCAAAAGG + Intronic
1070101431 10:73391290-73391312 GCAAGAAGGTTGGAATCAAATGG - Intronic
1072725836 10:97813229-97813251 GCAGCCATCTTGCCATCAAAAGG - Intergenic
1073434141 10:103506064-103506086 GCAGCCAGGATGGCATTCTAGGG - Intronic
1075685697 10:124363918-124363940 GCAACCAGGTAAGCACCAAAGGG + Intergenic
1075849146 10:125573535-125573557 GCAGCCAGGAGGGCAGCAGAGGG - Intergenic
1082840833 11:57688574-57688596 GCATCCAGGTGCGCATGAAATGG + Exonic
1086497822 11:87422241-87422263 GGTGCCAGGTTGGCATGAAGAGG - Intergenic
1088131835 11:106501360-106501382 TCTGCCAGGTTGGCATGCAATGG + Intergenic
1088627200 11:111737794-111737816 ACAGCCAGGTGGACACCAAAAGG - Intronic
1090277879 11:125432364-125432386 GGAGCCAGGCTGGGAGCAAAGGG - Exonic
1092001325 12:5034768-5034790 GCAGCCTGGTTGAGATCAGAAGG - Intergenic
1093224443 12:16464890-16464912 GCAGTCAGATGGGAATCAAAAGG - Intronic
1100707068 12:97212479-97212501 GCAGCCATTTTGGCACCAAGAGG + Intergenic
1102414532 12:112749046-112749068 GCTTCCAGGTAGGCAACAAATGG - Intronic
1118113160 14:62745689-62745711 CCAGGCAGGATGGCTTCAAAAGG - Intronic
1118766094 14:68910127-68910149 GCTGCAGGGTTGGCATCAAAGGG - Intronic
1120107607 14:80514923-80514945 GCAGCCATGTCTGCATTAAAGGG + Intronic
1121338700 14:93092520-93092542 GCAGCCAGGCTGGGACCAGAAGG + Intronic
1121473864 14:94175623-94175645 GCAGCCGAGTAGGCATGAAAAGG - Intronic
1123052965 14:105556027-105556049 GCAGCCAGGTAGGCAGCTGAAGG - Intergenic
1123077548 14:105676417-105676439 GCAGCCAGGTAGGCAGCTGAAGG - Intergenic
1123628065 15:22241166-22241188 TCAGCCAGGCTGGCATCCAAGGG - Intergenic
1128321523 15:66698099-66698121 ACAGGCAGAATGGCATCAAATGG + Intergenic
1128575680 15:68773032-68773054 ACAGCCAGGAAGGCACCAAATGG - Intergenic
1128606225 15:69038539-69038561 GTAGCCAGGGAGGCATCACAGGG + Intronic
1129223753 15:74153032-74153054 GCAGCCAGGATGGGAGCAGAAGG - Intergenic
1129696599 15:77743764-77743786 GCAGCTGGGTGGGCATCAAAAGG + Intronic
1133490156 16:6260398-6260420 GCAGCCAGGTTGGAATGAAGTGG + Intronic
1135201255 16:20439513-20439535 GAAGCGATGTTGGCTTCAAATGG + Intronic
1135217852 16:20588351-20588373 GAAGCGATGTTGGCTTCAAATGG - Intergenic
1136126432 16:28185726-28185748 GCTGCCAGGATGGCAGCACAAGG + Intronic
1139832268 16:69809726-69809748 TCACCCAGGCTGGCATCCAATGG - Intronic
1141975885 16:87516168-87516190 TCAGCCCGGCTGGCATCCAAGGG + Intergenic
1150451507 17:65272586-65272608 GCAGCCAGGCTGGAATGCAATGG - Intergenic
1151707062 17:75774703-75774725 GCAGCCAGCTTAGCCTCAATGGG + Intergenic
1153279307 18:3399170-3399192 GTAGCCAGGCTGGAAGCAAAAGG - Intergenic
1153535813 18:6100704-6100726 TCAGCCAGGGTGGCATCCAGGGG - Intronic
1155482923 18:26308830-26308852 GCTGCCAGGTTGGAGTGAAATGG - Intronic
1160954467 19:1684183-1684205 GCAGTCAGGGTGGGATCAGAGGG + Intergenic
1164287900 19:23838114-23838136 TCAGCAAAGTTGGCATAAAAAGG - Intergenic
1164571761 19:29379842-29379864 GCAGCCAGGTTGGAAGCTGAGGG - Intergenic
1164939203 19:32238872-32238894 GCAGCCAGTTAGACATCAAATGG - Intergenic
1165095278 19:33406764-33406786 GCAGCCACCTTGGCCTCACATGG - Intronic
1166663917 19:44665752-44665774 GCAGCCATCTTGGCACCAGAGGG - Intronic
1167431720 19:49459019-49459041 GCAGCCAGGATGGCATTTAAGGG + Exonic
1167501192 19:49849588-49849610 GCTGCCAGGTTGTCCTCACATGG + Intergenic
1168599415 19:57706085-57706107 GAAATCAGGGTGGCATCAAATGG - Intronic
926586793 2:14695505-14695527 ACAGCCAGGTTGGCCTCACAGGG + Intergenic
926992059 2:18690534-18690556 GCAGCCAGGGTGGCAGCAAGGGG + Intergenic
927363174 2:22261283-22261305 GCAGCAAAATTGGCATAAAAGGG - Intergenic
927432495 2:23038957-23038979 TCACCCAGGCTGGCATGAAATGG + Intergenic
928101540 2:28440234-28440256 GGAGCCAGGTTGTCAGAAAATGG + Intergenic
930035971 2:47085380-47085402 GCAGCCATCTTCTCATCAAAGGG + Intronic
930262155 2:49160393-49160415 GCAGGCTGGTTGGCATCACATGG - Intergenic
940746950 2:157577940-157577962 GCAGCCAGGTTGGAGTGCAATGG + Intronic
941568875 2:167143662-167143684 GAAGACAGGTTTGCATGAAAAGG + Intronic
943236164 2:185322539-185322561 TCACCCAGGTTGGAATCCAATGG - Intergenic
948259978 2:236596520-236596542 TGAGCCAGGTTGGCATCCTAAGG + Intergenic
948698446 2:239745968-239745990 GCAGCTAAGTTGGTATGAAAGGG + Intergenic
1168796543 20:613518-613540 GCAGCAAGGTTGGCAAAAAGTGG - Intergenic
1169422211 20:5469866-5469888 GCAGCCAGGATGACAGCACATGG + Intergenic
1171439543 20:25149035-25149057 GCAGCCAGGTCGGCTGCGAAAGG + Intergenic
1172823204 20:37757337-37757359 GCAGCCAGGAAGGCAGCATAAGG + Intronic
1177973613 21:27820554-27820576 GAAGCCTGGTTTGCATCAAAAGG + Intergenic
1180064619 21:45406007-45406029 GGCGCTCGGTTGGCATCAAAGGG - Intronic
1181029959 22:20144904-20144926 GCAGCCAGGTGGGCACTGAATGG - Intronic
1183420537 22:37709228-37709250 GCAGCCTGGTCGGCACCACAGGG - Intronic
1185021018 22:48375375-48375397 GCTGCCAGGTTTGGAGCAAAAGG - Intergenic
949130464 3:494046-494068 GCAACAAGGTTGACAACAAAAGG + Intergenic
954603242 3:51888723-51888745 GGAGCCAGGCTGGGCTCAAATGG + Intergenic
956952044 3:74294093-74294115 ACAGGCAGGTTTGCATCACAGGG - Intronic
960096539 3:113696013-113696035 GCAGCCAGGTTCACACCAGATGG - Intronic
961316707 3:126041599-126041621 CCAGCCAGGCTGGCATTCAATGG + Intronic
964862842 3:161221324-161221346 ACAGCCAGGTTGGCAGCTGACGG + Intronic
968522823 4:1041853-1041875 GCAGCCAGCCTGTCCTCAAAGGG + Intergenic
969365082 4:6689656-6689678 GCGGCCATGTGGGCCTCAAAAGG + Intergenic
971220485 4:24701094-24701116 GCAGACAGGTTCGCCTCATATGG + Intergenic
973219579 4:47710554-47710576 ACAGCCAGGCTGGCCTCACAGGG + Intronic
976703854 4:88001433-88001455 TCATTCATGTTGGCATCAAAAGG + Intergenic
976921799 4:90451756-90451778 GCAGCCAAATTGGCAGCAAGAGG - Intronic
981343948 4:143653695-143653717 GCAGCCAAGTTGGAAACAATGGG - Intronic
985145961 4:186894783-186894805 GAAACCAGGAAGGCATCAAATGG + Intergenic
985228509 4:187789302-187789324 TCAGCCAGGTTGGGAACAAGTGG + Intergenic
986023828 5:3831284-3831306 ACAGGCAGGTTGGCCTGAAAGGG + Intergenic
989040365 5:37221252-37221274 GAAGCCAGGCTGGCAACATAGGG + Intronic
990551703 5:56887437-56887459 GCAGCCAGGTTGGCATCAAAAGG + Exonic
991604869 5:68391180-68391202 GAAGCCAGGTGCTCATCAAAGGG - Intergenic
994840604 5:104920638-104920660 TCAGCCAGGTTGGTATCACTAGG + Intergenic
998462744 5:142321638-142321660 TTAGCCAGGTTGTCATCACAAGG + Intronic
999124891 5:149239671-149239693 GCAGGCAGGTGGGCATGACATGG - Intronic
999137432 5:149331868-149331890 GCAGCCATTGTGGCATCACAAGG - Intronic
999269195 5:150286559-150286581 GCAGCCAGGTTGGCCCTAAAAGG - Intronic
1000569135 5:162889840-162889862 GCAGCCATCTTGGAATCATAAGG + Intergenic
1001115070 5:168932609-168932631 GCAGCCTGGTGGGCAGCCAATGG + Intronic
1002184821 5:177449420-177449442 GTAGCCAGGATGGGATCACATGG + Intronic
1004915610 6:20329154-20329176 GCAGCCTGGTTGGCATCACCAGG - Intergenic
1006614586 6:35317848-35317870 GCAGCCAGGCTGGCCTCACTGGG - Intronic
1007545976 6:42695005-42695027 GCTCTCAGGATGGCATCAAATGG - Intergenic
1009744969 6:67799910-67799932 GCAGCCATATTTGCATCAATGGG - Intergenic
1010084381 6:71899737-71899759 ACAGCCATGTTGGGATCATATGG - Intronic
1012257155 6:97047448-97047470 GGAGCAAGGTTGGAAGCAAATGG + Intronic
1017342622 6:153343454-153343476 GAAGGCAGGTACGCATCAAAGGG + Intergenic
1017822149 6:158057273-158057295 GCAGCAAGGTCGGCATCATACGG - Intronic
1019195767 6:170281797-170281819 GGGGCCATGTTGGCGTCAAACGG + Intergenic
1019894402 7:3972475-3972497 GCAGACAGGTGGGCATCAGTGGG + Intronic
1020759516 7:12251086-12251108 GCAGCCAAATTGGCTGCAAAAGG + Intergenic
1021332832 7:19359660-19359682 GCAGCCATCTTGCCATCATAAGG - Intergenic
1022183816 7:27947797-27947819 GCAGCCAGGTGGGAATCAGTGGG - Intronic
1022719498 7:32930179-32930201 GCAGCCAGGTCAGAATAAAAAGG + Intergenic
1023122349 7:36922671-36922693 GCTGCCGGGAGGGCATCAAAGGG + Intronic
1024559521 7:50631581-50631603 GAAGCCAGGTTGTAATCACAGGG + Intronic
1025993511 7:66513427-66513449 GCATCCAGTTTGTCATCAAGAGG + Intergenic
1026034903 7:66823997-66824019 GCATCCAGTTTGTCATCAAGAGG - Intergenic
1026115270 7:67490614-67490636 GCAGCCAGGTTGGGAGGAGAAGG - Intergenic
1026984684 7:74547265-74547287 GCATCCAGTTTGTCATCAAGAGG + Exonic
1027214842 7:76177106-76177128 GCATCCAGTTTGTCATCAAGAGG + Intergenic
1032791441 7:135245970-135245992 GCAGCCATGTTGGCTTCCAGAGG + Intronic
1037700284 8:21267586-21267608 CCAGCCAAGATGGCATAAAAAGG + Intergenic
1037803320 8:22046557-22046579 GCAGCCGGGTTCGCATCAAAGGG + Exonic
1038231376 8:25703789-25703811 ACAGCAAGATTGGCATCAATGGG - Intergenic
1041513865 8:58678564-58678586 GCAACCAAGATGGCACCAAAAGG + Intergenic
1042002980 8:64147079-64147101 GAAGCCAGTTAGCCATCAAAAGG - Intergenic
1043379496 8:79687480-79687502 ACACCCTGGTTGGCATCAATAGG + Intergenic
1044486484 8:92760589-92760611 GGAGCAAGGTTGTAATCAAATGG - Intergenic
1047165762 8:122436604-122436626 GCAGTCAGGTTGTTTTCAAAAGG - Intergenic
1048002358 8:130389327-130389349 CCAGCCATCTTGGCATCACATGG - Intronic
1049339116 8:142102520-142102542 GCATCCAGGTTGGCAGGGAAGGG - Intergenic
1050559190 9:6817239-6817261 TCACCCAGGTTGGCATGCAATGG + Intronic
1051999945 9:23266263-23266285 AGAGCCATGTTGGCATTAAAGGG + Intergenic
1060110128 9:120901041-120901063 GCTGCCAGGCTGGCATCAGTAGG + Intergenic
1189139671 X:38589060-38589082 GCAGCCAGGTTAGCATTAGAAGG + Intronic
1189175106 X:38948872-38948894 GCAGCCAGGCAGGCAGGAAAGGG - Intergenic
1193202033 X:78702918-78702940 AAAGCAGGGTTGGCATCAAAAGG - Intergenic
1201222462 Y:11785284-11785306 GCAGCCAGGCAGGCAGGAAATGG - Intergenic
1201637595 Y:16142580-16142602 GCATCTATGTTTGCATCAAATGG - Intergenic