ID: 990559007

View in Genome Browser
Species Human (GRCh38)
Location 5:56965249-56965271
Sequence GAAGCCTATGTGTACCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990559007_990559013 -8 Left 990559007 5:56965249-56965271 CCCTAGGGGTACACATAGGCTTC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 990559013 5:56965264-56965286 TAGGCTTCCCAGGGGCAAGTGGG 0: 1
1: 0
2: 1
3: 20
4: 176
990559007_990559012 -9 Left 990559007 5:56965249-56965271 CCCTAGGGGTACACATAGGCTTC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 990559012 5:56965263-56965285 ATAGGCTTCCCAGGGGCAAGTGG No data
990559007_990559014 -2 Left 990559007 5:56965249-56965271 CCCTAGGGGTACACATAGGCTTC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 990559014 5:56965270-56965292 TCCCAGGGGCAAGTGGGCACTGG 0: 1
1: 0
2: 0
3: 23
4: 275
990559007_990559017 16 Left 990559007 5:56965249-56965271 CCCTAGGGGTACACATAGGCTTC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 990559017 5:56965288-56965310 ACTGGTCACTTTAAGCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990559007 Original CRISPR GAAGCCTATGTGTACCCCTA GGG (reversed) Intronic
901765754 1:11499091-11499113 GAATTCAATGTGGACCCCTAGGG + Intronic
902198294 1:14814669-14814691 GAAGCCTCGGTGTACCCCATGGG - Intronic
904837133 1:33346284-33346306 GAGGCTTTTGTGTACCCCTCAGG - Intronic
905674389 1:39815669-39815691 GAAGGCTCTGTGTAACCCTAAGG + Intergenic
905690723 1:39940788-39940810 GAGGCCAAAGTGTACCTCTAAGG - Intergenic
921780080 1:219152541-219152563 GCATCCCATCTGTACCCCTAAGG + Intergenic
1066089558 10:32004215-32004237 TCAGCCCATGTGTACCCCAATGG - Intergenic
1067805724 10:49391647-49391669 GAAGCCTGTGTGTCTCCCTTTGG + Intronic
1069693783 10:70372105-70372127 GAAGCCTATGTCTCCTCCCAGGG + Intronic
1075591576 10:123695258-123695280 AAAGACGATGTGTACCCCTTGGG + Intergenic
1080653911 11:34243736-34243758 GAAGCCTATGGTTAGACCTAAGG + Intronic
1081882350 11:46464493-46464515 GAAGCCTATCTGTAGACCCAAGG - Intronic
1086216300 11:84385951-84385973 GTAACCAATGCGTACCCCTAAGG + Intronic
1091965385 12:4736347-4736369 GAAGACTATGTGCATACCTAAGG + Intronic
1096514314 12:52147802-52147824 GAAGGCTCTGTGTGCCCCTCAGG - Intergenic
1114076684 14:19165022-19165044 GAGGCCTATGTGTCAACCTAGGG + Intergenic
1114085479 14:19234546-19234568 GAGGCCTATGTGTCAACCTAGGG - Intergenic
1131629361 15:94159868-94159890 GAAGTCTCTGTGTACACTTAAGG - Intergenic
1135520861 16:23176952-23176974 GAAACATATGTGTACCCTTTGGG + Intergenic
1143563629 17:7709072-7709094 GAAGCCCATGGGGACCCCCAGGG + Intronic
1146185681 17:30722644-30722666 GAACTCTGTCTGTACCCCTAAGG + Intergenic
1151757281 17:76082077-76082099 GAGGCCTAGGTGCACACCTAGGG + Intronic
1153950780 18:10056053-10056075 CAAAACTATTTGTACCCCTAAGG + Intergenic
1158908500 18:62037198-62037220 GAAGCAGTTGTATACCCCTAAGG + Intergenic
1162973099 19:14193076-14193098 GAACTCTGTCTGTACCCCTAAGG - Intronic
1164737163 19:30550270-30550292 AAAGCATATGGGTACCCCAAAGG + Intronic
930393902 2:50795775-50795797 AAAGCCTTTGTGTATCCCTATGG + Intronic
937778382 2:125808370-125808392 GAAGCCCATGTATAAACCTAGGG + Intergenic
938491283 2:131762527-131762549 GAGGCCTATGTGTCAACCTAGGG + Intronic
938496279 2:131799799-131799821 GAGGCCTATGTGTCAACCTAGGG - Intronic
940249912 2:151663809-151663831 GAAGCCAATGTGTTTCCCTTTGG + Exonic
941978228 2:171429023-171429045 GTACCTTATGTGAACCCCTAGGG + Intronic
944445949 2:199788883-199788905 GAATTCTATGTGTAACTCTATGG + Intronic
1172590352 20:36113374-36113396 GAAGTATCTTTGTACCCCTAGGG + Intronic
1173097156 20:40045878-40045900 TTAGCCTATGTGTTCCCCAATGG + Intergenic
1173263655 20:41459110-41459132 GAATCCTATGTTTGCCCATAAGG + Intronic
1173271059 20:41535279-41535301 GAAGCCCTAGTGTACCCATATGG - Intronic
1173295603 20:41753033-41753055 GAAGCCTATATGTACCAATATGG + Intergenic
1175717948 20:61268052-61268074 GAATGCTCTTTGTACCCCTAAGG + Intronic
1180292494 22:10858647-10858669 GAGGCCTATGTGTCAACCTAGGG + Intergenic
1180495300 22:15888069-15888091 GAGGCCTATGTGTCAACCTAGGG + Intergenic
1180705246 22:17805609-17805631 CAAGCCTCTGTGGAACCCTAAGG + Intronic
1180949673 22:19715362-19715384 CAAGCCTATTTGTACCCACAGGG - Intronic
952049893 3:29372076-29372098 GAAGCTTATGTGCACTTCTACGG - Intronic
952756667 3:36874878-36874900 TAAGTCTTTGTGTACCCCCAGGG - Intronic
955182056 3:56682339-56682361 GAAGCCGTTGTGTCCTCCTAAGG - Intronic
955438240 3:58927442-58927464 GAATCCTCTGTGTACTCATAAGG - Intronic
957508665 3:81158443-81158465 TTAGCCTATGTGTGCCCTTAAGG - Intergenic
961908570 3:130289221-130289243 GAAGGCTATGTGTAGACATAGGG + Intergenic
966656285 3:182361962-182361984 GAAGCCTTTTTGTTCCTCTAAGG + Intergenic
976267381 4:83196874-83196896 GAAGCCTATGTGAGGCTCTAGGG + Intergenic
980202216 4:129670552-129670574 GAAGCCTCTGTCCACCCCTATGG + Intergenic
990559007 5:56965249-56965271 GAAGCCTATGTGTACCCCTAGGG - Intronic
990702970 5:58495549-58495571 GAATCCTATGTGTATCGCTGTGG + Exonic
990834549 5:60002175-60002197 TCAGCCTATGTGTATCCTTAAGG - Intronic
992133455 5:73718813-73718835 GAAGTCCCTGTGCACCCCTAGGG - Intronic
992154885 5:73945313-73945335 GATGCCTAAGTGTACCGCTAAGG + Intergenic
998784790 5:145697416-145697438 AAAGCCTATGTGTACCAGCAGGG + Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1011531145 6:88322389-88322411 GAACCCTATGCTAACCCCTAGGG + Intergenic
1016785728 6:148008882-148008904 CAAGACTATGTATAGCCCTAAGG - Intergenic
1024235356 7:47393573-47393595 GAAGCCCATGAGCACCCCCAGGG - Intronic
1049725560 8:144144102-144144124 GAGGCCTCTGTGGACCCCTATGG + Intergenic
1053645378 9:40116910-40116932 GAGGCCTATGTGTCAACCTAGGG + Intergenic
1053760336 9:41346617-41346639 GAGGCCTATGTGTCAACCTAGGG - Intergenic
1053779469 9:41589811-41589833 GAAGGATATGTGAAGCCCTAAGG + Intergenic
1054167425 9:61800052-61800074 GAAGGATATGTGAAGCCCTAAGG + Intergenic
1054326399 9:63714811-63714833 GAGGCCTATGTGTCAACCTAGGG + Intergenic
1054539195 9:66259062-66259084 GAGGCCTATGTGTCAACCTAGGG - Intergenic
1054670117 9:67780848-67780870 GAAGGATATGTGAAGCCCTAAGG - Intergenic
1055799077 9:80012819-80012841 GAAGGCTATGTGCACACTTAGGG - Intergenic
1057224788 9:93287219-93287241 GCAGCCTCTGAGCACCCCTAGGG - Intronic
1186069059 X:5797879-5797901 GAAAACCATGTGTACCCCAAAGG + Intergenic
1190633015 X:52406950-52406972 TAAGCCTAAGTGTCACCCTATGG + Intergenic
1192209063 X:69115940-69115962 GAAGGCTATGAGTATCCCTGAGG + Intergenic
1192362252 X:70447236-70447258 GAAGCCTCTGGGTACCACTGGGG + Intronic
1197097576 X:122613653-122613675 GAAGCCTATATATATCTCTAAGG - Intergenic
1197623766 X:128780822-128780844 CAGGCCTACGTGTAGCCCTAAGG + Intergenic
1200283995 X:154803530-154803552 TAAACCTATGTGTTCCCTTATGG - Intronic