ID: 990559256

View in Genome Browser
Species Human (GRCh38)
Location 5:56967153-56967175
Sequence CTCAAATGGTAGAAGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1340
Summary {0: 1, 1: 16, 2: 78, 3: 325, 4: 920}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990559256_990559267 18 Left 990559256 5:56967153-56967175 CCTTGTCCCTTCTACCATTTGAG 0: 1
1: 16
2: 78
3: 325
4: 920
Right 990559267 5:56967194-56967216 CCATCTATGAACCAGGAAAAGGG 0: 2
1: 58
2: 282
3: 528
4: 1018
990559256_990559264 11 Left 990559256 5:56967153-56967175 CCTTGTCCCTTCTACCATTTGAG 0: 1
1: 16
2: 78
3: 325
4: 920
Right 990559264 5:56967187-56967209 AAGATGGCCATCTATGAACCAGG 0: 16
1: 71
2: 140
3: 283
4: 677
990559256_990559265 17 Left 990559256 5:56967153-56967175 CCTTGTCCCTTCTACCATTTGAG 0: 1
1: 16
2: 78
3: 325
4: 920
Right 990559265 5:56967193-56967215 GCCATCTATGAACCAGGAAAAGG 0: 14
1: 103
2: 236
3: 417
4: 811
990559256_990559263 -5 Left 990559256 5:56967153-56967175 CCTTGTCCCTTCTACCATTTGAG 0: 1
1: 16
2: 78
3: 325
4: 920
Right 990559263 5:56967171-56967193 TTGAGGACACAGGGAGAAGATGG 0: 4
1: 97
2: 335
3: 741
4: 1907

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990559256 Original CRISPR CTCAAATGGTAGAAGGGACA AGG (reversed) Intronic
900823345 1:4907208-4907230 CTCACATGGTGGAAGGGATGAGG + Intergenic
900874176 1:5329803-5329825 CTCACATGGTGGAAGGGGAAGGG + Intergenic
901218929 1:7571247-7571269 CTCACAGGGTGGAAGGGGCAAGG + Intronic
902320792 1:15664059-15664081 ATAAAATGATGGAAGGGACAAGG - Exonic
903388730 1:22948138-22948160 CTCACATGGTGGAAGGCAGAAGG - Intergenic
903733137 1:25512764-25512786 TTCACATGGTGGAAGGGGCAAGG - Intergenic
905110762 1:35592809-35592831 CTCACATTGTAGAAGGGAGAAGG + Intronic
905286754 1:36885647-36885669 CTCAGAGGGTGGAAGGAACATGG - Intronic
905827081 1:41034013-41034035 ATCAAATGAAAGAAGGGATATGG - Exonic
905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG + Intergenic
906068707 1:43001804-43001826 CTTACATGGTAGAAGGGGCAAGG + Intergenic
906173670 1:43749854-43749876 CTCATATGGCAGAAGGCAGAAGG - Intronic
906259336 1:44374669-44374691 CTCAGATGGTAGAAGAGGCAAGG - Intergenic
906730040 1:48072925-48072947 CTCACATGGTGGAAGGCAGAAGG - Intergenic
907023909 1:51095850-51095872 CTCAAATATTTGAAGGGACTTGG - Intergenic
907269602 1:53283198-53283220 CTCACGTGGTGGAAGGGGCAAGG - Intronic
907591231 1:55673463-55673485 CTCCAATGGCTAAAGGGACAAGG - Intergenic
907693368 1:56694637-56694659 TTCACATGGTGAAAGGGACAAGG + Intronic
907706257 1:56835069-56835091 CACAGATGGTAGAAGGAGCAAGG - Intergenic
907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG + Intronic
907877259 1:58503653-58503675 CTCACATGGTAGAAGGGGCAAGG - Intronic
907928346 1:58975577-58975599 CTCACATGATGGAAGGGATAAGG + Intergenic
908089594 1:60671812-60671834 TTCACATGGTGGAAGGGGCAAGG - Intergenic
908176354 1:61559029-61559051 CTCACGTGGTGGAAGGGACAAGG + Intergenic
908262020 1:62346437-62346459 CTCAAACAGTGGAAGGGGCAAGG - Intergenic
908267357 1:62392578-62392600 CTCAAATGGTGGAAGGGTAAGGG - Intergenic
908429323 1:64040683-64040705 CTCACATGGTAGGAGAGGCAGGG + Intronic
908554636 1:65245559-65245581 CTCACATGGTGGAAGGGGAAAGG + Intergenic
908631479 1:66114127-66114149 CTCACATCGTGGAAGGGCCATGG - Intronic
908727149 1:67188756-67188778 CTCACATAGTAGAAGGGGCCAGG + Intronic
908809604 1:67966546-67966568 CTCACAGGGTGGAAGGGGCAAGG - Intergenic
908905857 1:69007939-69007961 CTCACATGGTGGAAGGGGAAAGG + Intergenic
909020442 1:70425449-70425471 CTCACATGGTAGAAGAGACAAGG + Intronic
909052416 1:70782630-70782652 CTCACATGGTGGAAGGGACAAGG - Intergenic
909107694 1:71433115-71433137 CTCACATGGCAGAAGGCAGAAGG - Intronic
909198324 1:72655769-72655791 CTCACATGGTGGAAGGGGCAAGG - Intergenic
909239392 1:73192847-73192869 CTCACATGGAAGAAGGGTTAAGG + Intergenic
909454680 1:75837167-75837189 TTCACATGGTAGAAGGGGCAAGG - Intronic
909589902 1:77335940-77335962 CTCACATGGTGAAAGGGACAGGG + Intronic
909707474 1:78604666-78604688 CTCACATGGTGGAAGGGGCCAGG - Intergenic
909878834 1:80847472-80847494 CTCACATGGCAGAAGGCAGAAGG + Intergenic
909926423 1:81442801-81442823 TTAAAATGGTAGATGGGAAATGG - Intronic
909933724 1:81527740-81527762 CTCAAATGGTGGAAAGGACAAGG - Intronic
910341443 1:86192962-86192984 CTTAGAGGGTAGAAGGCACAGGG + Intergenic
910401872 1:86845541-86845563 TTCAAATGGTAGCAGGGACTAGG - Intergenic
910483042 1:87679321-87679343 CTCATGTGGTAGAAGGGGCAAGG - Intergenic
910544645 1:88400117-88400139 CTCACATGGTAGAAGGGGCAAGG + Intergenic
911111651 1:94194593-94194615 CTCACATGATAGAAGGGGAAGGG + Intronic
911197588 1:95011283-95011305 CTTAAATGGTAGAAGGGATGAGG - Intronic
911255480 1:95628306-95628328 CTCACATAGTGAAAGGGACAAGG - Intergenic
911386143 1:97177945-97177967 TTCACATGGTGGAAGGGGCAAGG + Intronic
911408233 1:97468439-97468461 CTCACATGATGGAAAGGACAAGG - Intronic
911669354 1:100591076-100591098 CTCACATGGTAGAAAGGATGAGG + Intergenic
911901696 1:103513917-103513939 ATCACATGGTAGGAGGGTCAAGG - Intergenic
911957655 1:104258819-104258841 CTCACATGGTGGAAGAGAAAAGG + Intergenic
911999735 1:104817629-104817651 CTCACATGGTGGAAGAGGCAAGG - Intergenic
912164895 1:107031275-107031297 CTCGCATGGCAGAAGGGGCAAGG - Intergenic
912269712 1:108196728-108196750 CTCACATGGTGGAAGGGGCAAGG + Intronic
912367328 1:109145179-109145201 CTCACATGGCAGAAGGTAGAAGG - Intronic
912415978 1:109508844-109508866 CTCAAAAAGCAGCAGGGACAAGG + Exonic
912444754 1:109726811-109726833 ATCAAAGGGTGGAAGGCACATGG - Intronic
912547525 1:110461633-110461655 CTCATATGGCAGAAGGTAGAAGG + Intergenic
912667611 1:111596743-111596765 CTCACATGGTAGAAGGGGTGAGG + Intronic
912908722 1:113734826-113734848 CTCACATGGTGGAAGGGGCAAGG - Intronic
913050288 1:115111657-115111679 CTCACATGGTAGAAGGGGAAGGG - Intergenic
913346322 1:117814443-117814465 CTCACATGGTGGAAGGGGCAAGG - Intergenic
913649201 1:120894434-120894456 CTCACATGGTGGAAGGGGCTAGG - Intergenic
914077496 1:144369073-144369095 CTCACATGGAGGAAGGGGCAAGG + Intergenic
914101683 1:144597432-144597454 CTCACATGGAGGAAGGGGCAAGG - Intergenic
914172403 1:145237613-145237635 CTCACATGGTGGAAGGGGCAAGG + Intergenic
914297281 1:146340079-146340101 CTCACATGGTGGAAGGGGCTAGG + Intergenic
914384157 1:147151381-147151403 CTTACATGGTAGAAGGCAGAGGG + Intergenic
914527048 1:148478616-148478638 CTCACATGGTGGAAGGGGCTAGG + Intergenic
914639350 1:149588519-149588541 CTCACATGGTGGAAGGGGCTAGG - Intergenic
914978385 1:152388998-152389020 CCCAAACAGTAGAAGGGAGAAGG + Intergenic
915739390 1:158107028-158107050 TTCACATGGTGGAAGAGACATGG + Intergenic
915841915 1:159220201-159220223 CTCATGTGGCAGAAGGGACAAGG + Intergenic
915863384 1:159471771-159471793 CTCAGTTGGCAGAAGGGGCAAGG - Intergenic
916086136 1:161270909-161270931 CTCACATGGTAGAAGGGGAGAGG - Intronic
916309824 1:163385698-163385720 CTCAGGTGGTAGAAGGGAGTGGG + Intergenic
916349445 1:163832418-163832440 CTCAGATGCTAGAAGTGAGAGGG + Intergenic
916539220 1:165736090-165736112 CTCACATGGTGGAAGGCACAGGG - Intronic
916581697 1:166114981-166115003 CTCAAATTTTAGAGGGGAAAGGG + Intronic
916882595 1:169034361-169034383 CTCACATGGGAGAAGGGGAAAGG + Intergenic
916925588 1:169517159-169517181 TTCAAATGGTGGAAGGAGCATGG + Intronic
917050620 1:170918236-170918258 CTCACATGGCAGAAGGTAGAAGG - Intergenic
917246990 1:173014162-173014184 CTCACATGGCAGAAGGCAGAAGG - Intergenic
918025494 1:180740893-180740915 CTCACATGGTAAAAGGGGCATGG + Intronic
918119647 1:181527262-181527284 CTCACATGGTAGAAGGGGTGAGG + Intronic
918338666 1:183548258-183548280 CTTAAATGGTAGCAGTGCCATGG + Intronic
918356946 1:183713621-183713643 CTCACATGGTAGAAGGGATGAGG - Intronic
918575566 1:186054985-186055007 CTCATATTGTAAAAGGGAGAAGG + Intronic
918689013 1:187457092-187457114 TACATATGGTACAAGGGACATGG - Intergenic
918726472 1:187931986-187932008 CTGCTACGGTAGAAGGGACATGG - Intergenic
918740619 1:188126706-188126728 CTCACATGGCAGAAGGTAGAGGG + Intergenic
918764991 1:188470002-188470024 CTCACATGGTGGAATGGTCAAGG - Intergenic
918822199 1:189269641-189269663 TTCAAATGGGGCAAGGGACATGG + Intergenic
919365979 1:196661534-196661556 CTCCAATGATGAAAGGGACAAGG + Intronic
919410604 1:197237401-197237423 CTCACATGGTGAAAGGGGCAAGG + Intergenic
919418167 1:197337176-197337198 CTCACATGGTAGAAGGGGTGAGG - Intronic
920831790 1:209472133-209472155 CTCACATGGTAGAGGGAATAAGG + Intergenic
921249745 1:213285843-213285865 CTCACATGGTGGAAGGGGCTAGG - Intergenic
921686464 1:218094749-218094771 CTCACATGGTAGAAGGGGCAAGG - Intergenic
921718983 1:218449785-218449807 CTCACATGGTAGCAGGGCCAAGG + Intergenic
921821601 1:219623131-219623153 CTCACATGGTGGAAGGGACAAGG - Intergenic
922218208 1:223538140-223538162 CTGGAAGGGTAGAAGGGACTAGG + Intronic
922253929 1:223875063-223875085 CTCACATGGTAGAAAGCAGAAGG - Intergenic
922514184 1:226194695-226194717 CTCACATGGTAGAAGGGACAAGG + Intergenic
922727537 1:227929840-227929862 CTCACATGGCAGAAGAGGCAAGG - Intronic
922885714 1:229019014-229019036 CTCACATGGTGGAAGGGATGAGG + Intergenic
923091654 1:230745596-230745618 CTCACATGGTGGAAGGGAGGAGG + Intergenic
923315908 1:232779872-232779894 CTCACATGGTAGAAAGGGCAAGG + Intergenic
923394968 1:233552783-233552805 CTCACATGGTGGAAGGGGCGAGG - Intergenic
923899721 1:238312401-238312423 CTCACATGGTGGAAGGGGCAAGG + Intergenic
924072655 1:240297919-240297941 CTCACATGGTAGAAGGGACAAGG + Intronic
924187591 1:241511220-241511242 CTCACATGGTAGAAGGGACAAGG - Intronic
924272681 1:242350079-242350101 CCCACATGATAGAAGGGGCAAGG - Intronic
924494870 1:244577602-244577624 CTCACATGGCAGAAGGGGCAAGG + Intronic
924798938 1:247313084-247313106 CTCACATGGTGGAAGGGGCAAGG + Intronic
924809651 1:247389865-247389887 CTCACATGGTGGAATGGACAAGG + Intergenic
1063010189 10:2014066-2014088 CTCATATGGTGGAAGGGCCAAGG - Intergenic
1064277626 10:13921156-13921178 CTTACATGGTAGAAAGGAAAAGG + Intronic
1064328193 10:14370373-14370395 CTCACATGGTGGAAGGCAGAAGG - Intronic
1064618155 10:17185224-17185246 ATCAAATGCTAGAAAGGACCAGG + Intronic
1064934083 10:20660687-20660709 CTCACATGGTGGAAGGGGCTGGG - Intergenic
1065327462 10:24561474-24561496 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1065460344 10:25956077-25956099 CTCACATGGCAGAAGGCAGAAGG + Intronic
1065857602 10:29842874-29842896 CTCACCTGGTGGAAGGGACCAGG + Intergenic
1066054576 10:31668500-31668522 CTCACATGGAAGAAGGGACAGGG + Intergenic
1066444342 10:35468193-35468215 CTCACATGGCAAAAGGGGCAAGG + Intronic
1066458275 10:35590741-35590763 CTCACATGGCAGAAGAGGCAGGG + Intergenic
1066645990 10:37609676-37609698 CTCACATGGTGGAAGAGGCAAGG - Intergenic
1066680105 10:37929944-37929966 CTCACATGATAGAAGGGGCAAGG + Intergenic
1066712030 10:38246548-38246570 CCCACATGATAGAAGGGGCAAGG + Intergenic
1067050203 10:43011582-43011604 CTCACATGGTGGAAGGGACAGGG - Intergenic
1067192521 10:44083205-44083227 ATAGAATGGTAGAAGGGTCAAGG - Intergenic
1067241543 10:44499295-44499317 CTCATATGGTGGAAAGAACAAGG + Intergenic
1067977529 10:51042882-51042904 TTCACGTGGCAGAAGGGACAAGG - Intronic
1068524778 10:58116087-58116109 CTCACATGGTAAAAGGGGCAAGG + Intergenic
1068590796 10:58851014-58851036 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1068766645 10:60771806-60771828 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1068902673 10:62287494-62287516 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1069036990 10:63656025-63656047 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1069268234 10:66490686-66490708 CTCATGTGGTAGCAGGGCCATGG + Intronic
1069596130 10:69672040-69672062 TTCACAAGGTAGAAGGGGCAGGG + Intergenic
1070311891 10:75279853-75279875 CTCACATGGCAGAAGGCACAAGG + Intergenic
1070487108 10:76941907-76941929 CTCACATGACAGAAGGGACGAGG + Intronic
1070532472 10:77349243-77349265 CTCACATGGTGGAAGGGGCAAGG - Intronic
1070557734 10:77542095-77542117 CTCACATGATGGAAGGGACCAGG - Intronic
1071177238 10:82940723-82940745 CTCACATGGTAGAAGGGGCAGGG + Intronic
1071237680 10:83668127-83668149 CTCAAATGGTGGAAGGGAGGAGG - Intergenic
1072642370 10:97221605-97221627 CTCACATGGTGGAAGGGACAAGG - Intronic
1073040476 10:100600994-100601016 CTCACATGGCAGAAGGGACAGGG + Intergenic
1073470649 10:103720186-103720208 CTCACATGATGGAAGGGGCAAGG + Intronic
1074079707 10:110157797-110157819 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1074244982 10:111680710-111680732 CTCACATGGCAGAAGGGACGGGG - Intergenic
1074244993 10:111680763-111680785 CTCATATGGCAGAAGGCAGAAGG - Intergenic
1074270592 10:111949888-111949910 CTCACATGGTACAAGGGGTACGG - Intergenic
1074489561 10:113927027-113927049 CTCACATGGCAGAAGGGGCTAGG - Intergenic
1074836470 10:117300782-117300804 CTCACATGGCAGAAGGGATAAGG - Intronic
1074939172 10:118218042-118218064 CTCGAACGATGGAAGGGACAAGG + Intergenic
1075098260 10:119487917-119487939 CTCACATGGTAGAAGGGGTGAGG - Intergenic
1075128507 10:119720332-119720354 CTCATGTGGTGGAAGGGGCAAGG + Intergenic
1075178293 10:120186044-120186066 CCCCTATGGTAGAAGAGACAGGG + Intergenic
1075196398 10:120363003-120363025 CTTATCTGGTAGAAGGAACAAGG - Intergenic
1075222337 10:120596074-120596096 CTCACATGGTGGCAGGGGCAAGG + Intergenic
1075350960 10:121724988-121725010 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1075456399 10:122587781-122587803 CTAAAATGTTAGAAGGATCAGGG - Intronic
1075456962 10:122591134-122591156 CTAAAATGTTAGAAGGATCAGGG - Intronic
1075989040 10:126817292-126817314 CTCACATGGTAGAAGGTGGAAGG - Intergenic
1076841239 10:133046708-133046730 CTCAGCTGGGAGATGGGACAGGG - Intergenic
1077861336 11:6183558-6183580 ATCATATGGCAGAAGGGATAAGG + Intergenic
1077956618 11:7027407-7027429 CTCACATGGCAGAAGGAACCAGG + Intronic
1078087120 11:8240632-8240654 CTCACGTGGCAGAAGGGGCAAGG + Intronic
1078225367 11:9386996-9387018 TTTAAATGGAAGAAGGGAGAGGG - Intronic
1078443168 11:11384415-11384437 CTCAAGTGGCAGCAGGGAGAAGG + Intronic
1078711051 11:13791493-13791515 CTCACATGCTGGAAGGAACAAGG - Intergenic
1079519121 11:21303921-21303943 CTCACATGGTGGAAGGCAAAAGG + Intronic
1079551269 11:21701452-21701474 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1079651385 11:22934317-22934339 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1079738497 11:24028228-24028250 TTCACATGGTAGAAGGGACAAGG + Intergenic
1079963820 11:26956095-26956117 TTCACATGGTGGAAGAGACAAGG + Intergenic
1079969163 11:27015459-27015481 CTCATGTGGCAGAAGGGACAGGG + Intergenic
1080024157 11:27596269-27596291 CTCATGTGGCAGAAGGAACAAGG - Intergenic
1080095763 11:28404472-28404494 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1080116446 11:28626490-28626512 CTCACATGGTGTAAGGGACAAGG + Intergenic
1080195483 11:29603624-29603646 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1080294093 11:30705281-30705303 CTCACATGGTGGAAGGGACAAGG + Intergenic
1080392119 11:31857991-31858013 CTCACATGGTAGAAGAGGCATGG - Intronic
1080397288 11:31901949-31901971 CTCACATGGCAGAAGGGGCAAGG + Intronic
1080597087 11:33782679-33782701 CTCACGTGGTAGAAGAGGCAAGG - Intergenic
1080654667 11:34249460-34249482 CTCAAATAGTAGAAAGCACTTGG + Intronic
1080695031 11:34596054-34596076 CTCACATGGCAGAAGGGACAAGG - Intergenic
1080762843 11:35269140-35269162 CTCACATGGTAGAAGGGCCAAGG - Intronic
1080802825 11:35623974-35623996 CCCAAGTGGTAGAAGGGCCGTGG + Intergenic
1080827055 11:35857254-35857276 CTCACCTGGTAGAAGGGACCTGG + Intergenic
1080942376 11:36933973-36933995 CTCACATGGTTGAAGGGGCAAGG + Intergenic
1081059485 11:38455644-38455666 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1081062666 11:38500011-38500033 CTCAAATGGTGGAAGGGGTAAGG - Intergenic
1081163514 11:39781864-39781886 CTCACGTGGTGGAAGGGTCAAGG - Intergenic
1081348305 11:42017676-42017698 CTCACATGGTGGTAGGGTCAAGG + Intergenic
1081660979 11:44888224-44888246 CTCAGATGCCAGAAGGCACATGG - Intronic
1082008868 11:47437281-47437303 CTTGCATGGTGGAAGGGACAAGG - Intergenic
1082782545 11:57299045-57299067 CATACATGGTAGAAGGGACAAGG - Intergenic
1082874775 11:57977318-57977340 CTCACATGGTGGAAGGGACAAGG - Intergenic
1082990227 11:59201150-59201172 CCCACATGGTAGAAGGGGCAAGG + Intronic
1082998171 11:59268984-59269006 CTCACATGGCAGAAGAGGCAAGG + Intergenic
1083140884 11:60720554-60720576 CTCACATGGCAGAGGGGCCAAGG + Intergenic
1083915833 11:65743254-65743276 CTCGCATGGTGGAAGGGGCAAGG + Intergenic
1084081102 11:66825521-66825543 CTCACATGGCAGAAGGGGCAAGG - Intronic
1084100266 11:66943317-66943339 CTCACAGGGTGGAAGGGACAAGG - Intronic
1084627702 11:70321172-70321194 CTCACATGATGGAAGGGACCAGG - Intronic
1085114230 11:73916155-73916177 TTCAAAAGGTTGAAGTGACATGG + Intronic
1085846454 11:80071388-80071410 TTCACATGGCAGAAGGGGCAAGG - Intergenic
1085906502 11:80770513-80770535 CTCACATGGTGGAAAGGGCAAGG - Intergenic
1085923942 11:80991849-80991871 CTCATATGGTGGAAGGGATGAGG + Intergenic
1086125886 11:83348054-83348076 GTCAGATGGCAGAAGGGTCAAGG - Intergenic
1087063170 11:94002638-94002660 CTTTAATGGTAGAAGGAAGAAGG + Intergenic
1087238200 11:95744689-95744711 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1087512458 11:99115002-99115024 CTCACATGGAAGAAGGGGGAAGG - Intronic
1087673662 11:101134248-101134270 CTCACATGGTAGAAGGGGCAGGG - Intergenic
1087678447 11:101189936-101189958 CTCACATGGTGGAAGAGGCAAGG - Intergenic
1087687717 11:101284245-101284267 CTCACATGGCAGAAAGGACAAGG - Intergenic
1087947808 11:104185446-104185468 CTCACATAGTGGAAGGGGCAAGG - Intergenic
1088338552 11:108736703-108736725 CTCACATGGCAGAAGGCAGAGGG - Intronic
1088840677 11:113625006-113625028 CTCACTTGGTGGAAGGGGCAAGG + Intergenic
1088960494 11:114658912-114658934 CTACCATGGAAGAAGGGACAAGG + Intergenic
1089188114 11:116634835-116634857 TTCACATGGTGGAAGGGGCAAGG + Intergenic
1089238748 11:117055847-117055869 CTCACATGGCAGAAGGCAGAAGG - Intronic
1089420536 11:118330094-118330116 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1089539992 11:119183999-119184021 CACAATTGGTAGAAGGCACACGG - Exonic
1089639541 11:119838715-119838737 CTCACATGCTGGAAGGGCCAAGG + Intergenic
1090374476 11:126279287-126279309 CTCACATGGCAGAAGGGGTAAGG + Intergenic
1090405204 11:126472408-126472430 CTCACAATGTGGAAGGGACAAGG + Intronic
1090848743 11:130552194-130552216 CTCACATAGTGGACGGGACAAGG - Intergenic
1090918560 11:131188104-131188126 CTCACATGGTGGAAGAGATAAGG + Intergenic
1091017243 11:132063142-132063164 CTCATGTGGTAGAAGGGGCAAGG + Intronic
1091195740 11:133729355-133729377 CTCACATGGCAGAAGGGACAAGG + Intergenic
1091521590 12:1249859-1249881 CTCACATGGTGGAAGGGGCAAGG + Intronic
1092231081 12:6775580-6775602 CTCCCAGGGTAGAAAGGACAGGG + Intronic
1092361470 12:7840189-7840211 CTCACATGGTGGAAGGCAGAAGG - Intronic
1092565881 12:9664991-9665013 CTCACATAGTAGAAGGAACAAGG - Intronic
1093269491 12:17041769-17041791 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1093480844 12:19602383-19602405 CTCATATGGCAGAGGGGGCATGG - Intronic
1093610858 12:21154344-21154366 CTCACATGTTAGAAGAGGCAAGG - Intronic
1093751559 12:22805855-22805877 ATCAAAGTGTAGAAGGGACATGG - Intergenic
1093769596 12:23003297-23003319 CTCACCTGGTAGAAGGGAAAAGG + Intergenic
1094126951 12:27033307-27033329 CTCACATGGTAGAAGAAGCAAGG + Intronic
1094237625 12:28186762-28186784 CTCATGTGGTGGAAGAGACAGGG - Intronic
1094442869 12:30498652-30498674 CTCACATGGTGGAAGGGATAAGG - Intergenic
1094643897 12:32302371-32302393 CTGAATTGGTGGAAGGGACACGG + Intronic
1095126314 12:38482121-38482143 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1095237219 12:39812194-39812216 CTCACATGGTAGAATGGAAGAGG + Intronic
1095354651 12:41257313-41257335 CTCACATGGTGGAAGAGGCAAGG + Intronic
1095431499 12:42139496-42139518 CTCACATGGTAGAAGAGGCGAGG - Intronic
1095695972 12:45144428-45144450 TTCACATGGTGGAAGGGGCAAGG + Intergenic
1095933794 12:47655229-47655251 CTCCCATGGGAGAAGGGACAAGG + Intergenic
1096619038 12:52850948-52850970 CTCAAGAGGAAGAAGAGACAGGG + Intergenic
1097533602 12:60837397-60837419 CTCACATGGTGGAAGGGCAAAGG - Intergenic
1098074588 12:66715334-66715356 CTCACAGGGTTGTAGGGACAGGG - Intronic
1098191721 12:67956232-67956254 CTCACATGGTTGAAGAGACAGGG - Intergenic
1098235521 12:68414540-68414562 CTCACATGGTGGAAGGGGAAAGG - Intergenic
1098535778 12:71592176-71592198 CTCACATGGTAGAAGGGCTGAGG - Intergenic
1098537264 12:71607088-71607110 CACAAATGGTAAAATGGATATGG - Intergenic
1098826451 12:75303712-75303734 ATTATATGGTAGAAGGGACATGG + Intronic
1098854010 12:75631754-75631776 CTCACATGGTAAAAGGCAGAAGG + Intergenic
1099242368 12:80153273-80153295 CTCAGATGGTGGAAGGAGCAAGG + Intergenic
1099303001 12:80921148-80921170 CTCACGTGGTAGAAGGGGCAAGG - Intronic
1099482310 12:83183253-83183275 CTCACATGGTAGAAAGGGCAAGG + Intergenic
1099790938 12:87332644-87332666 TTCACATGGTGGAAGGGACAGGG - Intergenic
1099842336 12:87981721-87981743 CTCAAGTGGGAGAAGGTTCATGG - Intronic
1100206054 12:92350950-92350972 TTCACATGGCAGGAGGGACAAGG - Intergenic
1100223739 12:92535257-92535279 CTCACATGGTGGAAGAGGCAAGG + Intergenic
1100266669 12:92983577-92983599 ATCAGATGGTTGAAGGGATATGG - Intergenic
1100288081 12:93186816-93186838 CTCACATGGTGGAAGGGACAAGG - Intergenic
1100406563 12:94277196-94277218 CTCACATGGTGGAAAGGGCAGGG + Intronic
1100468554 12:94871164-94871186 CTCACATCATGGAAGGGACAAGG + Intergenic
1100474682 12:94924533-94924555 CACATATGGAAGAAGGGACCTGG - Intronic
1100806303 12:98287498-98287520 CCCACATGGCAGAAGGGGCAAGG - Intergenic
1101042752 12:100773177-100773199 CTCACATGGTAGATGGGACAAGG + Intronic
1101288809 12:103344873-103344895 CTGAACTGGGAGAAGTGACATGG + Intronic
1101469265 12:104981375-104981397 CTCACATGGTAGAAGGGACAAGG - Intergenic
1102414321 12:112747304-112747326 CTCACATGGTGGAAGGGCAAGGG - Intronic
1102734838 12:115150245-115150267 CTCAAACAGCAGAAGGGGCAAGG + Intergenic
1102782923 12:115581075-115581097 CTCAAATGGTTGCAAGGAGAAGG + Intergenic
1102812909 12:115839796-115839818 CTCACGTGGTGGAAGGAACAAGG + Intergenic
1102817686 12:115880965-115880987 TTCTCATGGTAGAAGGGCCAAGG - Intergenic
1103076404 12:117986309-117986331 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1103301146 12:119927419-119927441 CTCAGACGGTGGAAGGGGCAAGG - Intergenic
1103966449 12:124642957-124642979 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1104979237 12:132566209-132566231 CTCACATGGTGGAAGGGGCTAGG + Intronic
1106139759 13:27002332-27002354 CTGAAAGGGCAGAAGGGAGATGG + Intergenic
1106609398 13:31264063-31264085 CTCATCTGGGAGAAGGGACGAGG + Intronic
1106610001 13:31269783-31269805 CTCACATGGCAGAAAGGGCAAGG - Intronic
1106782725 13:33075894-33075916 CTCACATGGTAGAAGGTAGAGGG + Intergenic
1106820273 13:33456732-33456754 CCCACATAGTGGAAGGGACAAGG - Intergenic
1106964850 13:35050934-35050956 CTCAAATAATAGCAGAGACAAGG + Intronic
1107041668 13:35955399-35955421 CTCACGAGGTAGAAGGGACAAGG + Intronic
1107076449 13:36326051-36326073 CTCACATAGTGAAAGGGACAAGG + Intronic
1107371360 13:39753248-39753270 GTCACATGGTAGAAGGGACAGGG - Intronic
1107414044 13:40184628-40184650 CTCACATGGCAGAAGGGATGAGG + Intergenic
1107557666 13:41531898-41531920 CTCACATGGCAGAAGAGAAAAGG + Intergenic
1108238925 13:48441218-48441240 CTCAGATGGTGGAAGGGACAAGG + Intronic
1108281457 13:48866287-48866309 CTCACATGGTTGAGGGGGCAAGG - Intergenic
1108825281 13:54406268-54406290 CTCACATGGTAGAAGCAGCAAGG + Intergenic
1109120523 13:58450146-58450168 CTCACTTGGCACAAGGGACAAGG - Intergenic
1109330008 13:60917917-60917939 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1109330231 13:60919919-60919941 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1109413503 13:62005652-62005674 CTCACATGGCAGAAGGCAAAAGG - Intergenic
1109433493 13:62267825-62267847 CTCTCATGGTAGAAGGGTCAAGG - Intergenic
1110161936 13:72388910-72388932 TTCACATGGTAGAAGAGGCAAGG - Intergenic
1110285054 13:73740236-73740258 TTCACATGGTAGAAGGAGCAAGG - Intronic
1110950650 13:81485818-81485840 TTCACATGATAGAAGGGTCAAGG - Intergenic
1111381167 13:87454703-87454725 CTCATATGGAAGAAGGGACAAGG - Intergenic
1111549428 13:89787070-89787092 CTCACACGGTAGAAGAGAAAAGG + Intergenic
1111641484 13:90976279-90976301 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1111649201 13:91068042-91068064 CTTGAAGGCTAGAAGGGACAAGG + Intergenic
1112028920 13:95439294-95439316 CTCACATGGTGGAAGGGGCAAGG + Intronic
1112034399 13:95483972-95483994 CTCATGTGGTGGAAGGGATAAGG - Intronic
1112243177 13:97702330-97702352 CTCATATGGTGGAAGAGGCAAGG + Intergenic
1112251466 13:97784464-97784486 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1112263728 13:97902930-97902952 CTCATATGGCAGAAGGTGCAGGG - Intergenic
1112283439 13:98082827-98082849 CTCATATGGTAGAAGGGACAAGG - Intergenic
1112523747 13:100122881-100122903 CTCACATGGTGGAAGGAGCAAGG + Intronic
1112786876 13:102961114-102961136 CACTCATGGTAGAAGGGAAAGGG + Intergenic
1112829285 13:103428870-103428892 CTCTCATGGTGGAAGGGACATGG + Intergenic
1112884032 13:104147014-104147036 CTCACATGGTAGAAGGAAGAAGG + Intergenic
1113035844 13:106047763-106047785 CTCACATGATGGAAGGGGCAAGG - Intergenic
1113389089 13:109878506-109878528 CGCACATGGTAGAAGGGCAAGGG - Intergenic
1113492573 13:110703996-110704018 CTCACATGGTAGAAGGTAGAGGG - Intronic
1113501542 13:110779362-110779384 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1114338539 14:21718250-21718272 TTCATCTTGTAGAAGGGACACGG - Intergenic
1114731291 14:24995191-24995213 CTCACATGGTAGAAGGAACAAGG + Intronic
1114936132 14:27539427-27539449 CTCACATGGTAGGAGAGATAAGG - Intergenic
1116054061 14:39840733-39840755 CTCACATAGTGGAAGGGACAAGG - Intergenic
1116503191 14:45646005-45646027 CTCACATGGTAGAAGAGCAAGGG - Intergenic
1116667935 14:47801451-47801473 CTCACGTGGCCGAAGGGACAAGG - Intergenic
1116700084 14:48230046-48230068 CTTACATGGTAGAAGAGGCAAGG - Intergenic
1116856120 14:49953763-49953785 TTCAAATGGGAGAAGGGAGATGG + Intergenic
1117287814 14:54304263-54304285 CTCATATGGCAGAAGGGGCAAGG - Intergenic
1117679204 14:58185832-58185854 CTCACATGGTGGAAGGGGCAAGG - Intronic
1117733078 14:58743474-58743496 CTCACATGGCAGAAGGCTCAAGG - Intergenic
1117820176 14:59640708-59640730 CAGAAATGAAAGAAGGGACATGG - Intronic
1118049943 14:62015689-62015711 CTCACATGGTAGAGGAGGCAAGG - Intronic
1118172994 14:63407848-63407870 CTCACATGGTGGAAGGCAGAAGG - Intronic
1118226653 14:63906922-63906944 CTCACATGGTAGAACGGGTAAGG + Intronic
1118266017 14:64295245-64295267 CTCAGGTGGCATAAGGGACATGG + Intronic
1118416989 14:65550170-65550192 CTCTCATGGTAGAAGGCAAAGGG + Intronic
1118620289 14:67608789-67608811 CTCACATGGTACAAGGGGCAAGG + Intergenic
1118948616 14:70413250-70413272 CTCAACTGTAAGAAGGGACTTGG - Intronic
1119432036 14:74574848-74574870 CTCAAATGGGAGAAGGGGGAAGG + Intronic
1119609134 14:76047009-76047031 CTCACATGGCAGAAGGCAGAAGG + Intronic
1119911472 14:78353439-78353461 CTCACATGGTGGAAGGGGCAAGG + Intronic
1120041939 14:79763696-79763718 CTTACATGGTGGAAAGGACAAGG + Intronic
1120115832 14:80616611-80616633 CGCAAATAGCAGAAGGGTCACGG + Intronic
1120413158 14:84184067-84184089 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1120671195 14:87364743-87364765 CTCACATAGTAAAAGGGGCAAGG + Intergenic
1121164378 14:91777781-91777803 CTTAGCTGGTAGAAGGGGCAAGG + Intronic
1121303546 14:92890513-92890535 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1121659412 14:95623949-95623971 CTCACATGGCAGAAAGGGCAAGG + Intergenic
1121881191 14:97501676-97501698 CTCATGTGGTTGAAGGGGCAAGG - Intergenic
1121886549 14:97548245-97548267 CTCACATGGTGGAAGAGACAAGG + Intergenic
1121927588 14:97942717-97942739 CTTGCATGGTTGAAGGGACAAGG + Intronic
1121941792 14:98077735-98077757 CTCACATGGCACAAGGGGCAAGG + Intergenic
1121968057 14:98328853-98328875 CTCACATGGTAGAAGGGCCCAGG + Intergenic
1122068754 14:99191656-99191678 CTGAAATGGCAGAGGGGGCAGGG + Intronic
1122203887 14:100138757-100138779 GCCACATGGTGGAAGGGACAGGG + Intronic
1123711052 15:22987941-22987963 TTCACATGGCAGAAAGGACAAGG - Intronic
1123762384 15:23442867-23442889 CAGTAAGGGTAGAAGGGACAGGG + Intronic
1123971485 15:25511849-25511871 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1124047396 15:26162867-26162889 CTCACATGGCCGAAGGGGCAAGG + Intergenic
1124159340 15:27254627-27254649 CTCACATGGTGGAAAGGACAAGG + Intronic
1124185727 15:27526937-27526959 CTGAGATAGTAGAAGGTACAGGG + Intronic
1124385625 15:29206227-29206249 CTCACCTGGCAGAAGAGACAAGG + Intronic
1124395949 15:29301826-29301848 CTCACATGGTGGAAGGGGCTGGG - Intronic
1124498072 15:30199909-30199931 CTCACATGGTAGAAGGCAGAAGG + Intergenic
1124572581 15:30878659-30878681 CACACATGGTGGAAGGGGCAAGG - Intergenic
1124618124 15:31257126-31257148 CTTACATAGTAGAAGGGACAAGG - Intergenic
1124628044 15:31320854-31320876 CTCACATGGTGGAAGGGGCCAGG + Intergenic
1124745510 15:32338761-32338783 CTCACATGGTAGAAGGCAGAAGG - Intergenic
1124839542 15:33229021-33229043 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1124888962 15:33713810-33713832 CTCACATGGTGGAAGAGGCAAGG + Intronic
1126124146 15:45280074-45280096 CTCACATGGCAGAAGGGACAAGG - Intergenic
1126153422 15:45543364-45543386 CTCACATGGTATAAGGGGCTAGG + Intergenic
1126341347 15:47644619-47644641 CTCAAAGGGCAGAAGGCAGAAGG - Intronic
1126358738 15:47823584-47823606 CTCACATGGTGGAAGGGGTAAGG - Intergenic
1127542316 15:59952901-59952923 CTCAAATGGTAGAAGGGACCAGG + Intergenic
1127783780 15:62338686-62338708 CTCACATGGTGGAAGGTAGAAGG + Intergenic
1128350586 15:66885759-66885781 CTCAAATGAAGGAAGGGGCAAGG + Intergenic
1128553705 15:68615686-68615708 CTCACATGGTGGAAGACACAAGG - Intronic
1128591788 15:68904493-68904515 CTCACATGGCAGAAGGCAGAAGG + Intronic
1128972994 15:72124805-72124827 ATCAAAAGGTAGAAGGAAAAAGG + Intronic
1129025140 15:72564811-72564833 CTCATATGGTGGAAAGGACAAGG + Intronic
1129429229 15:75486393-75486415 CTCACATGGCAGAAGGGGAAGGG - Intronic
1129485663 15:75869585-75869607 CTCACATGGTAGAAGGCAGAAGG + Intronic
1130031483 15:80318252-80318274 CTCAGGTGGTAGAAGGGGCATGG + Intergenic
1130265759 15:82401595-82401617 CTCACATGGTAGCAGGCAGAAGG + Intergenic
1130429610 15:83833356-83833378 CTCACATGGCAGAAGGGATGAGG + Intronic
1130506256 15:84545320-84545342 CTCACATGGTAGCAGGCAGAAGG - Intergenic
1130685545 15:86033900-86033922 CTCACATGGTGGAAGGAAGAAGG + Intergenic
1130687456 15:86051336-86051358 CTCACAAGGTAGAAAGGGCAGGG + Intergenic
1130770587 15:86919869-86919891 CTGAAATGGGACAAGGGAGAAGG + Intronic
1130949806 15:88576890-88576912 CTCATATGGTGGAAGGGGCAAGG - Intergenic
1131345175 15:91640161-91640183 CTCACATGGTGGAAGGGTGAGGG + Intergenic
1131465896 15:92654847-92654869 TGCAGATGGTAGAAGGGAGAGGG + Intronic
1131539954 15:93267663-93267685 CTCACATGGTAGAGGGAACAAGG + Intergenic
1131560743 15:93437243-93437265 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1133707627 16:8370198-8370220 CTCACATGGTGGAAAGGGCATGG + Intergenic
1134310226 16:13069841-13069863 CTCACAGGGCAGAAGGGCCAAGG - Intronic
1135086840 16:19481910-19481932 CCCACGTGGTAGAAGGGGCAAGG - Intronic
1135618995 16:23937000-23937022 CTGAAATTGTAGTAGGTACAGGG + Intronic
1136678245 16:31935413-31935435 CTTAAATGGTGGAAGGCAAATGG - Intergenic
1137002623 16:35243094-35243116 TGCACATGGCAGAAGGGACAAGG - Intergenic
1137025982 16:35475069-35475091 CTTCAATGGCAGAAGGGACAAGG - Intergenic
1137805494 16:51301096-51301118 CTCACATGGTGAAAGGGGCAAGG + Intergenic
1137863850 16:51873442-51873464 TTCACATGGCACAAGGGACAAGG - Intergenic
1138317173 16:56080383-56080405 CTCATTTGGCAGAAGGGGCAAGG + Intergenic
1138397162 16:56713867-56713889 CTCACATGGCAGAAGGCAGAAGG + Intronic
1138692269 16:58779473-58779495 CTCACATGGTGAAAGGGTCAAGG + Intergenic
1138693216 16:58788181-58788203 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1138694353 16:58797867-58797889 CTCATATGGTGGAAGGGGCAGGG + Intergenic
1138730005 16:59184105-59184127 CTCACATGGTGGAAGGGTGAGGG + Intergenic
1138909681 16:61381128-61381150 CTCAAATAGCTGAAAGGACACGG + Intergenic
1139022814 16:62772864-62772886 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1139212734 16:65095895-65095917 CTCAAATAGTGGAAGAGGCAGGG - Intronic
1140066855 16:71618722-71618744 CTCACATGGTAAAAGGAGCAAGG - Intergenic
1140231090 16:73117826-73117848 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1140706871 16:77638965-77638987 CTCACATGGCAGAAGGGGCCAGG - Intergenic
1140838372 16:78816255-78816277 CTCAAATGCTAGAAAAGAAAAGG - Intronic
1140879860 16:79188177-79188199 CAGAGATGGGAGAAGGGACAAGG + Intronic
1140886559 16:79249456-79249478 CTCACATGGTGGAAGGGGCATGG - Intergenic
1140916621 16:79499620-79499642 TTCATATGGGGGAAGGGACAAGG - Intergenic
1141042422 16:80683774-80683796 CTCACATGATAGAAGGGGCAAGG - Intronic
1141099994 16:81190531-81190553 CTCAAATGGAAGAAGCCTCAGGG + Intergenic
1141371085 16:83486960-83486982 CTTTAATGCTAGAAGGGAGAGGG + Intronic
1142087861 16:88193857-88193879 CTCACATGGCGGAAGGGGCAAGG + Intergenic
1143339620 17:6200543-6200565 CTTACATGGTAGGAGGGGCAAGG + Intergenic
1143414772 17:6738284-6738306 CTCAAGTGGTAGAAGGGGGCAGG - Intergenic
1143453507 17:7051038-7051060 ATCAACTGGAAGAAGGGAGATGG + Intergenic
1143880708 17:10027583-10027605 CTCACATGGTGGAAGGCAGAAGG - Intronic
1144125927 17:12202829-12202851 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1144671562 17:17135611-17135633 CTCACATGTTAGAAGGGGCAAGG + Intronic
1144938157 17:18916819-18916841 CTCAGATGGTGGAAGGAGCAAGG + Intronic
1145102541 17:20088904-20088926 CTCACATGGCAGAAGGGGCAAGG - Intronic
1145837530 17:27965863-27965885 CTCACATGGTGGAAGGGGCAGGG + Intergenic
1148971933 17:51491254-51491276 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1149200615 17:54181912-54181934 CTCACATGATGGAAGGGGCAAGG - Intergenic
1149436043 17:56634223-56634245 TACACATGGTGGAAGGGACAAGG + Intergenic
1150719033 17:67598562-67598584 CTCACATGGTAGAAGGGACAAGG - Intronic
1150858170 17:68773236-68773258 CAAAAATGGTAGAAAGGATATGG + Intergenic
1150886337 17:69090558-69090580 CTTAAATGTTACAAAGGACAAGG - Intronic
1150998551 17:70347522-70347544 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1151145453 17:72036337-72036359 CTCACATGGCATAAGGGAAAAGG + Intergenic
1151532793 17:74717860-74717882 CTCACATGGTAGAAGGGGCAAGG - Intronic
1151998930 17:77632585-77632607 CTCACATGGTAGAAGGGTGGGGG - Intergenic
1152145486 17:78566035-78566057 CTTACATGGCAGAAGGGGCAAGG - Intronic
1152908312 17:82982540-82982562 CTCACGTGGTGGGAGGGACAAGG - Intronic
1153097288 18:1421507-1421529 CTCACATGGCAGAAGAGAGAAGG + Intergenic
1153100911 18:1468592-1468614 CTCACATGGTGGAAGGGACAAGG - Intergenic
1153189928 18:2526613-2526635 CTTGCATGGTGGAAGGGACAAGG - Intergenic
1153674809 18:7447470-7447492 CTCACATGGTAGAAGGCAGAAGG + Intergenic
1153967893 18:10198147-10198169 TTCATGTGGTAGAAGGGGCAAGG + Intergenic
1154938653 18:21088769-21088791 CTCACATGGTAGAAGGCAAAAGG - Intronic
1155359971 18:24990160-24990182 CTCATATGGCAGGAGGGACTTGG - Intergenic
1155553118 18:26987804-26987826 CTCACATGGTGGAAAGGGCAAGG - Intronic
1155650922 18:28140540-28140562 CTCACATGGTAGAAGAGGCAAGG - Intronic
1156173474 18:34514741-34514763 CTCACATGGTGGAAAGGGCAAGG + Intronic
1156210957 18:34942186-34942208 CTCAAATTCTAGAAGGTAAATGG - Intergenic
1157130356 18:45001620-45001642 CACAAATGGTACAAGAGAAATGG - Intronic
1157445133 18:47738763-47738785 TTCCAATGGTAGAAAGGGCAAGG + Intergenic
1157517899 18:48324009-48324031 TTCACATGGTGGAAGGGTCAAGG - Intronic
1157735203 18:50041829-50041851 GTCAAATGGGAAAAGGGAAAAGG + Intronic
1157924633 18:51749850-51749872 CTCCCATGGTAGAAGGGACAAGG + Intergenic
1158125464 18:54095548-54095570 TTCACATGGTAGAAAGGGCAAGG - Intergenic
1158158547 18:54453355-54453377 GTCAAATTGGAGAAGGGGCATGG - Intergenic
1158313053 18:56179405-56179427 CTCACATGGTGGAAGAGATAAGG - Intergenic
1158638187 18:59179614-59179636 CTCACAGGGTAGAAGGGGCTGGG + Intergenic
1158670712 18:59471208-59471230 CAGAAATGGTAGGAGAGACAGGG - Intronic
1158727562 18:59987377-59987399 CTCACATGGCAGAAGGGCAAGGG - Intergenic
1159270377 18:66141556-66141578 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1159358212 18:67364435-67364457 CTCACATGGGAGAAGGGACAAGG + Intergenic
1159407787 18:68027769-68027791 CTCACATGGTGGAAAGGGCAAGG + Intergenic
1159858657 18:73619217-73619239 CTCATATGATGGAAGGGGCAAGG + Intergenic
1160132652 18:76242144-76242166 CTCACATGGTAGAAGGGATGAGG - Intergenic
1162545157 19:11324777-11324799 TTCCCATTGTAGAAGGGACAGGG - Exonic
1162971283 19:14182820-14182842 CTCCAAAGGTTGAAGGGACACGG - Intronic
1163894794 19:20049282-20049304 CTCACATGGCAAAAGAGACAAGG + Intergenic
1164290633 19:23865915-23865937 ATCAAAAGGTGGAAGGCACATGG - Intergenic
1165339381 19:35199758-35199780 TTGAACTGGCAGAAGGGACAGGG + Intergenic
1165642007 19:37397695-37397717 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1165642252 19:37399681-37399703 CTCACATGGCAGAAGGCAAAAGG + Intergenic
1165929172 19:39344924-39344946 CTCAAAGGGGAGAAGGAAGAAGG - Intronic
1166172642 19:41042291-41042313 CTCACATGGTAAAATGAACAAGG - Intergenic
1166570830 19:43796056-43796078 CTCATGTGGTGGAAGGGGCAAGG + Exonic
1167152002 19:47715597-47715619 GTCAAATGATGGAAGGGAGAAGG + Intronic
1168281737 19:55309571-55309593 TTCACATGGCAGAAGGGGCAAGG + Intronic
925038477 2:710690-710712 CTCACACAGCAGAAGGGACAGGG - Intergenic
925214131 2:2078994-2079016 CTTACATGGTGGAAGGGCCAGGG - Intronic
925483361 2:4301409-4301431 CTCACATGGTGGAAGGGACAAGG - Intergenic
925504412 2:4544718-4544740 CTCACATGGCAGAAGAGGCAAGG + Intergenic
925556051 2:5132670-5132692 CTCACATGGGGGAAGGGACGAGG - Intergenic
925675571 2:6357925-6357947 CTCATGTGGTGGAAGAGACAAGG - Intergenic
925843071 2:8010349-8010371 CTCATATGGTAGAAGGGGTGTGG + Intergenic
925880641 2:8349611-8349633 CTCACATGGCAGAAGGCAGAGGG + Intergenic
925897582 2:8484931-8484953 CCCAAGTGGAAGAAGAGACAGGG + Intergenic
926041742 2:9679216-9679238 CTCACATGGTGGAAGGGGCAAGG - Intergenic
926041889 2:9680090-9680112 CTCACATGGTAGAAAGGGGAAGG + Intergenic
926426721 2:12744929-12744951 CTCACACGGTGGAACGGACAAGG - Intergenic
926474073 2:13300352-13300374 CTCAAATGATAGAATGGAACAGG + Intergenic
926866389 2:17363647-17363669 CTCATGTGGTAGAAGGCAGAGGG - Intergenic
926933893 2:18067643-18067665 CTCACATGGTGAAAGGGACAAGG - Intronic
927084686 2:19662774-19662796 CTCACATGATGGAAGGGGCAAGG + Intergenic
927417574 2:22894657-22894679 CTCGATTGGCAGAAGGGAGATGG + Intergenic
927466103 2:23337815-23337837 CTCACATGGTGGAAGGCAGAAGG - Intergenic
928006695 2:27568762-27568784 CTCAAATGGTAGAATGTAGGAGG + Intergenic
928440016 2:31284536-31284558 CTCACATGGTGGAAGGGGCCAGG - Intergenic
928653110 2:33422577-33422599 TTCACATGGTGGAAGGGACAAGG - Intergenic
928801204 2:35094971-35094993 TTCACATGGCAGAAGGGGCAAGG + Intergenic
928856927 2:35813711-35813733 GTCAAATGGGAGATGGGCCATGG - Intergenic
929072014 2:38040444-38040466 CTTACATGATGGAAGGGACAAGG - Intronic
929129035 2:38547962-38547984 CTCACATGGCAGAAGGAGCAGGG - Intergenic
929228119 2:39531630-39531652 CTCACATGGTGGAAGGGGGATGG + Intergenic
929831125 2:45347351-45347373 CTCACATGGCAGAAGGAGCAAGG + Intergenic
929965561 2:46532656-46532678 CTCACATGGTAGAAGGGAAAAGG - Intronic
930100446 2:47599104-47599126 CTCACATGGTGGAAGAGGCAAGG - Intergenic
930151643 2:48066231-48066253 CTCAGATGGTAAAGGGGATAGGG + Intergenic
930572232 2:53101841-53101863 CTCATATGGCAGAAGGCAAAAGG + Intergenic
930602684 2:53459961-53459983 GTTACATGGTAGAAGGGGCAAGG - Intergenic
930605945 2:53493172-53493194 CTCACATGGGAGAAGGGGCAAGG - Intergenic
930618887 2:53624138-53624160 CTCAAATGGTAGAAGGGATGAGG - Intronic
931084256 2:58811565-58811587 CTCAAATGGAAGGAAGGAAAGGG - Intergenic
931146628 2:59526669-59526691 CTCACATAGTGGAAGGGGCAAGG - Intergenic
931178057 2:59873193-59873215 CTAAAATGGGAGGAGGAACAGGG + Intergenic
932261955 2:70334409-70334431 ATCACATGGTGGAAGAGACAAGG - Intergenic
932359286 2:71091317-71091339 CTCATATGGTGGAAGGGGCAAGG - Intergenic
932507440 2:72249258-72249280 CTCAAAAAATAAAAGGGACAAGG - Intronic
932639768 2:73432601-73432623 CTCCCATGGTGGAAGGGGCAGGG + Intronic
932837675 2:75052250-75052272 CTCAGATGGTGGAAGGGGCAAGG - Intronic
932943917 2:76204414-76204436 CTTGCATGGTAGAAGGGGCAAGG - Intergenic
933238368 2:79890892-79890914 ATCACATGGTGGAAGGGGCAGGG + Intronic
933649211 2:84835768-84835790 TTCACATGGTGGAAGGCACAAGG + Intronic
933775803 2:85770579-85770601 GTCAAATGGGAGAAGAGAAACGG - Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
935011224 2:99137952-99137974 CTCATATGTTAGAAGGGGCAAGG - Intronic
935272578 2:101447952-101447974 CTCACATGGCAGAAGGCAGAAGG + Intronic
935400544 2:102655864-102655886 CTCACATGGCAGAAGGCAGAGGG + Intronic
935524425 2:104148031-104148053 CTCACATGGTGGAAGGGGCTGGG - Intergenic
935586972 2:104809455-104809477 CTTACATGGTGGAAGGGGCAAGG - Intergenic
935809659 2:106785201-106785223 CTCACATTGTGGAAGGGGCAGGG + Intergenic
935851438 2:107224379-107224401 CTCACATGGTAGAAGGGGTGAGG + Intergenic
935895582 2:107734005-107734027 CTCACATGGTTGAAGACACAAGG + Intergenic
936053898 2:109246346-109246368 CTCCCATGGTAGAGGGGGCAAGG + Intronic
936262976 2:110978252-110978274 CTCACATGGCAGAAGGCAGAAGG + Intronic
936311441 2:111388376-111388398 CTCACATGGTAGAGGGGATGAGG - Intergenic
936596900 2:113856778-113856800 CTCACATGGCAGAAGGCAGAAGG - Intergenic
936619459 2:114080421-114080443 ATCACATGGTGGAAGGGACAAGG + Intergenic
937433880 2:121864147-121864169 CTCACATGGTGGAAGGGGAAAGG - Intergenic
937466479 2:122137394-122137416 CTCACATGGTGGAAAGGGCAAGG - Intergenic
937797620 2:126042529-126042551 CTCACATGGTGGAAAGGACAAGG - Intergenic
938556856 2:132432277-132432299 CTCACATGGTGGAAGGGGCAAGG + Intronic
938598485 2:132812878-132812900 CTCAAGTGGTAGAAAGGACAAGG + Intronic
938684281 2:133721864-133721886 CTCACATGGTGAAAGGGGCAAGG - Intergenic
938945876 2:136211639-136211661 TTCACATGGTAGAAGGAGCAAGG + Intergenic
938961487 2:136345511-136345533 CTCACATGGCAGAAGGAGCAAGG + Intergenic
939119570 2:138100388-138100410 CTCACATGGTAGAAGGAGCCTGG + Intergenic
939269263 2:139916685-139916707 TTCACATGGTGGAAGGGGCAAGG - Intergenic
939499370 2:142963499-142963521 CTCACATGGCAGAAGGGCTAAGG + Intronic
939826099 2:147017229-147017251 CCCACATGGTGGAAGGGGCAAGG + Intergenic
939877666 2:147596098-147596120 TTCAAATCTGAGAAGGGACATGG + Intergenic
940038868 2:149338549-149338571 CTCACATGGCAGAAGAAACAAGG - Intronic
940285560 2:152029780-152029802 CTCAAATGGTAGAAGGGGCAAGG - Intronic
940372781 2:152921408-152921430 CTCACATGGTAGAAGGGGCAAGG + Intergenic
940385204 2:153063635-153063657 CTCACATGGTGGAAGAGGCAGGG - Intergenic
940478723 2:154200629-154200651 CTCACATGGCAGAAGGTAGAAGG + Intronic
940570184 2:155422166-155422188 CTCACATGGTGGAAAGGGCAAGG + Intergenic
940580635 2:155575135-155575157 CTCACATGGTAGAAAAGGCAAGG - Intergenic
940770522 2:157834884-157834906 TTCACATGGTGGAAGGGATAAGG - Intronic
941197228 2:162467906-162467928 CTCAGGTGGTGGAAGGGGCAAGG + Intronic
941348839 2:164406127-164406149 CTCACATGGCAGAAGGAGCAAGG - Intergenic
941722926 2:168831234-168831256 CTCAGATGGCAGAAGGGGCTAGG + Intronic
941856279 2:170234367-170234389 CTCACATGGCAGAAGGCAGAAGG + Intronic
942264669 2:174210531-174210553 CTCATAAGGTATAAGGGAAAGGG + Intronic
942650692 2:178164348-178164370 CTCAAATGGTTGAAGGGGCAAGG + Intergenic
942718239 2:178919075-178919097 CTCACATGGTGGAAGGGGCAAGG - Intronic
942866283 2:180679174-180679196 CTCAAATGGTAGAAAGGGGCAGG - Intergenic
943195623 2:184744478-184744500 CTCACATGGTGGAAGGGGCATGG - Intronic
943990240 2:194680493-194680515 CTCCCATGGTGGAAGGAACAAGG + Intergenic
944150733 2:196555323-196555345 CTTATGTGGTGGAAGGGACAAGG + Intronic
944167083 2:196734507-196734529 CTCACATGGTGGAAGGCAGAAGG - Intronic
944388779 2:199195125-199195147 CTTAAATGATAGAGAGGACAAGG - Intergenic
944467609 2:200018793-200018815 CTCACATGGCAGAAGGGGTAAGG + Intergenic
944577778 2:201106241-201106263 CTCATATGGTAGAAGGGGCAAGG - Intergenic
944597832 2:201277995-201278017 ATCAAATGTTAGCAGGGACCAGG - Intronic
944995823 2:205292283-205292305 CTCACATGGTGGAAGGGTCAAGG - Intronic
945064015 2:205932991-205933013 CTCATATGATAGAAGGGATGAGG - Intergenic
945319503 2:208405839-208405861 CTCACATGGCAGAAGGGATGAGG - Intronic
945497068 2:210521738-210521760 CTCAAATTTTAGAATTGACAAGG - Intronic
945650412 2:212551637-212551659 CTCCCATGATAGAAGGGGCAAGG + Intergenic
945664630 2:212725455-212725477 CTCGAATGTCAGAAGGGACAGGG + Intergenic
945930724 2:215852551-215852573 CTCACATGGCAGAAGGGTCAAGG + Intergenic
945940464 2:215944281-215944303 ATCAAATGATAGAAATGACAAGG - Exonic
946151229 2:217772814-217772836 CTCACATGGTGAAAGGGGCAAGG + Intergenic
946443147 2:219713969-219713991 CTCATATGGCAGAAGGGGTAGGG - Intergenic
946447913 2:219755353-219755375 CTCATATGGTAGAAGGGACAAGG - Intergenic
946907406 2:224430047-224430069 CTCAGTTGGTAGAGGGGAGATGG + Intergenic
946972352 2:225108565-225108587 CTCACATGGTGGAAGGGGCAAGG + Intergenic
947047436 2:226004505-226004527 CTCATATGGTAGAAGGTGGAAGG + Intergenic
947069821 2:226276189-226276211 CTCACATGGCAGAAGGAGCACGG + Intergenic
947082580 2:226415217-226415239 CTCATATGGCAGAAGGCAGAAGG - Intergenic
947288641 2:228546570-228546592 CTCACATGGTGGAAGGGGCTGGG + Intergenic
947361787 2:229352847-229352869 CTCACATGGTGGAAGGGACAGGG - Intergenic
947436432 2:230076766-230076788 CTCACATGATAGAAGGGGCAGGG + Intergenic
947845136 2:233237708-233237730 CTCACATGGTAGGAGGAGCAAGG + Intronic
947883296 2:233540979-233541001 TTCAAATGGAAGATGGCACATGG - Intronic
947994965 2:234519509-234519531 CTCACATGGTGGAAGGGGCAAGG + Intergenic
948281547 2:236751095-236751117 TTCAAATGGTAGAAGGGGTGAGG + Intergenic
948582955 2:239000333-239000355 CTCACATGGTGGAAGGGGCAAGG + Intergenic
948765997 2:240219354-240219376 CTCACATGGCAGAAGGGGTAAGG + Intergenic
949019623 2:241734128-241734150 CTGAACAGGCAGAAGGGACAGGG + Intergenic
1168802224 20:650920-650942 CTTACATGGGAGAAGGGACTTGG + Intronic
1168907656 20:1418849-1418871 CTCTAGTGGTAGAAGAGACCTGG - Intergenic
1169331401 20:4719309-4719331 CCCACATGGCAGAAGGGACAAGG + Intergenic
1169635794 20:7690038-7690060 CTCACATGGTAGAAGGAAAAAGG - Intergenic
1169747137 20:8953912-8953934 CTTGCATGGCAGAAGGGACAAGG + Intronic
1170020091 20:11827791-11827813 TTCACATGGTAGAAGGGGCAAGG - Intergenic
1170033789 20:11969379-11969401 CTCAAATGCTAAGTGGGACATGG - Intergenic
1170064172 20:12292624-12292646 CTCACATGGTGGAAGGGACAGGG - Intergenic
1170075093 20:12410474-12410496 CTCACATGGTGAAAGGGGCAAGG - Intergenic
1170353105 20:15463947-15463969 CTAAAATCATAGAAGGGACTAGG - Intronic
1170552506 20:17489849-17489871 CTCACATGCTAGAAGGGATGAGG + Intergenic
1170796938 20:19556052-19556074 CTCACATGGTGGAAGGGGCAAGG + Intronic
1170946808 20:20898768-20898790 CTCATATGGTAGAGGGGATGAGG - Intergenic
1171221187 20:23399385-23399407 CTCACGTGGTGGAAGGAACAAGG - Intronic
1171336057 20:24386606-24386628 CTCATATGGTGGAAGGTAGAAGG - Intergenic
1171394800 20:24825112-24825134 CTCACATGGTAGAAGACAAAGGG + Intergenic
1171534057 20:25870610-25870632 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1171571231 20:26253484-26253506 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1172168791 20:32916213-32916235 CTCACATGGTAGAGAGGACAAGG + Intronic
1172980115 20:38935115-38935137 CTCAATGGGGAGGAGGGACAAGG + Intronic
1173234174 20:41228572-41228594 CTCACATGGCAGAAGGGACCAGG + Intronic
1173433002 20:43008279-43008301 TTCACATGGTGGAAGGGGCAAGG - Intronic
1173439196 20:43060349-43060371 CTCACATGGTGTGAGGGACAAGG + Intronic
1173574582 20:44103936-44103958 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1173589325 20:44211686-44211708 CTCAGATGGTAGGCGGGAAAAGG + Intergenic
1174144550 20:48442283-48442305 CTCAAACGACAGAAGGGGCAAGG + Intergenic
1174517766 20:51106296-51106318 CTCACATGGCAGAAGGGGAAAGG - Intergenic
1174840960 20:53901046-53901068 ATCAAATGGGATAAGGGGCAGGG - Intergenic
1175181565 20:57152019-57152041 CTCACATGGTAGATGGGATGAGG + Intergenic
1175596495 20:60238929-60238951 CTCACATGGTGGCAGGTACAAGG - Intergenic
1175916676 20:62429204-62429226 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1176937276 21:14881987-14882009 CTCACATGGTGGAAGGGCCAAGG + Intergenic
1176965287 21:15205754-15205776 CTCACAGGGTAGAAAGGGCAAGG - Intergenic
1177223785 21:18227097-18227119 CTCACATAGTGGAAGGGGCAAGG + Intronic
1177338441 21:19763788-19763810 CCCACATGGTGGAAGGGGCAAGG - Intergenic
1177446639 21:21205860-21205882 CTCACATGGTAGAATGGACTAGG + Intronic
1177498450 21:21918834-21918856 CTCACATGGTGAAAGGGATAAGG + Intergenic
1177676252 21:24304678-24304700 CTCATATAGTGAAAGGGACAAGG + Intergenic
1177748993 21:25256587-25256609 CTCATATGATGAAAGGGACAAGG + Intergenic
1177802358 21:25840379-25840401 CTCACATGGTAGAAGGGCAAGGG + Intergenic
1177882772 21:26714528-26714550 CCAAAATGGTAGAATGGTCAGGG + Intergenic
1177930663 21:27279010-27279032 CTCACATGGTGGAAGCGCCAAGG + Intergenic
1178136882 21:29637591-29637613 CTCACATGGTGAAAGGGGCAAGG - Intronic
1178169373 21:30021555-30021577 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1178291202 21:31370016-31370038 CTCATGTGGTGGAAGGGAAAGGG - Intronic
1178969756 21:37162901-37162923 TTCTCATGGTGGAAGGGACAAGG + Intronic
1179058818 21:37960562-37960584 CTCACCTGGTGGGAGGGACAAGG + Intronic
1179284862 21:39968564-39968586 CTCACATGGTGGAAGGGGTAAGG + Intergenic
1179335226 21:40445093-40445115 CTCACATGGTGGAAGAGACAAGG + Intronic
1179350051 21:40600362-40600384 CTCACATGGTGGAAGAGACAAGG + Intronic
1180573408 22:16750504-16750526 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1182011305 22:27002946-27002968 CTGAAATGGAAGTAGGGGCAAGG - Intergenic
1182483486 22:30625351-30625373 CTCACATGGTGGAAGGAACATGG + Intronic
1182782100 22:32876198-32876220 CTTACATGGCAGAAGGGGCAAGG + Intronic
1182817638 22:33180007-33180029 CTCACATGGCAGAAGGCAGAAGG - Intronic
1182910722 22:33982002-33982024 CTCAAAGGTGAGAAAGGACATGG + Intergenic
1182920540 22:34075215-34075237 CTCACATGGCAGAAGGGGGAAGG + Intergenic
1182931147 22:34175489-34175511 CTCACATGGTGGAAGGGCCAAGG + Intergenic
1183007558 22:34916181-34916203 CTCACAGGGTGGAAGGGGCAAGG - Intergenic
1183513481 22:38249574-38249596 CTCATGTGGTAGAAGGGGCATGG - Intronic
1184350168 22:43938014-43938036 CTCACACAGTAGAAGGGACAAGG - Intronic
1184559784 22:45255549-45255571 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1184970138 22:48013814-48013836 CTCACGTGGTAAAAAGGACAAGG - Intergenic
1185201808 22:49511488-49511510 CTCATATAGTGGAAGGGGCAAGG - Intronic
949281905 3:2355898-2355920 TTCAAATTGTAGCAGGGGCAGGG + Intronic
949316007 3:2756360-2756382 CTCACATGGCAGAAGGAGCAAGG - Intronic
949319619 3:2794856-2794878 CTCACGTGGTGGAAGGGGCAAGG + Intronic
949598937 3:5577847-5577869 CTCATGTGGTAGAATGGGCAAGG - Intergenic
949603268 3:5624948-5624970 CTCAAATGGCAAAAGGGATGAGG - Intergenic
949681453 3:6519248-6519270 TTCATCTGGTAGAAGGGACAAGG + Intergenic
949768845 3:7556163-7556185 CTCACGTGGTAGAAAGGACAAGG + Intronic
949778693 3:7661445-7661467 ATCAAATGTTAGAAGGGATTTGG + Intronic
949844809 3:8358421-8358443 CTCAAATGGTAAAGAGGCCAGGG + Intergenic
949865850 3:8546582-8546604 CTACTATGGTAGAAGGGACATGG + Intronic
949931530 3:9082381-9082403 TTCACATGGTGGAAGGGGCAAGG - Intronic
949976571 3:9466366-9466388 CCCAAATGCTACAAGGGATAAGG - Intronic
950201541 3:11048098-11048120 GTCCAATGGGAGAAGGGACCTGG + Intergenic
950688875 3:14639803-14639825 GTCACATGGTAGAAGGGGTAAGG + Intergenic
950782010 3:15400188-15400210 CACAAATTCTAGAAGGGAGAGGG - Intronic
950896631 3:16457943-16457965 CTCACATGGTGGAAGGCAGAAGG - Intronic
951247836 3:20361636-20361658 TCAACATGGTAGAAGGGACAAGG + Intergenic
951480234 3:23153113-23153135 CTCACATGGTAGAAGGGATGAGG + Intergenic
951756646 3:26098097-26098119 CTAAAATGGTCTAAGGGATATGG - Intergenic
951890470 3:27563554-27563576 CTCAGATGGTGGAAGAGGCAAGG + Intergenic
952058515 3:29478389-29478411 CTCACATGATGGAAGTGACAAGG + Intronic
952113294 3:30149382-30149404 CTCACATGGTGGAAGGCAGAAGG - Intergenic
952510389 3:34047749-34047771 CTCACATGGCAGAAGAGCCAAGG - Intergenic
952686243 3:36151823-36151845 CTCATATGGTGGAAGGCAAAAGG + Intergenic
952748264 3:36802514-36802536 CTAATATGGTAGAAAGGGCAAGG - Intergenic
952808903 3:37384040-37384062 CTCACATGGTGGAAGGCAGAAGG - Intergenic
953221757 3:40978112-40978134 CTCCAAAGGTAGGAGGGAAAAGG + Intergenic
954525949 3:51271423-51271445 CTCACATAGCAGAAGGGGCAAGG + Intronic
955241648 3:57183241-57183263 CTCACATGGCAGAAGGGGAAAGG + Intergenic
955515653 3:59724033-59724055 CTCACATGGTGGAAGGGGCAAGG + Intergenic
955525941 3:59819912-59819934 CTCACATGGTGGAAGGGAGAAGG - Intronic
955541437 3:59980685-59980707 CTCACATGGTGGAAGGGATGAGG - Intronic
955572370 3:60321843-60321865 CTTCAGTGGTAGAAGGGGCAAGG + Intronic
955805351 3:62728250-62728272 CCCAGATGGTAGAAAGAACATGG - Intronic
956041557 3:65150390-65150412 CTCACGTGGTGGAAGGGGCAAGG - Intergenic
956280134 3:67547174-67547196 CTCACGTGGTAGAAGGGATGAGG - Intronic
956726794 3:72163056-72163078 CTCAAAAGGTAAAGTGGACAGGG + Intergenic
956747789 3:72323296-72323318 CTCACAGAGTGGAAGGGACAAGG + Intergenic
956840066 3:73131125-73131147 CTCAGATGATGGAAGGCACAAGG + Intergenic
956840196 3:73132623-73132645 CTCAAATGGTAGAAAGGGTAAGG + Intergenic
956887947 3:73579178-73579200 CTCACATGGTGAAAGGGGCAAGG - Intronic
956919187 3:73908267-73908289 CTCACATGGCAGAAGGCAGAAGG - Intergenic
956957343 3:74356124-74356146 CTCACATGGTAGAAGGGGCAAGG - Intronic
957013152 3:75031027-75031049 ATCCAATGGTAGAAGGCAGAAGG - Intergenic
957461488 3:80526830-80526852 CTCACATGGTGAAAGAGACAAGG - Intergenic
957941302 3:87007810-87007832 CTTATATGGTAGAAGGGGCAAGG - Intergenic
958124282 3:89335287-89335309 CTCAGATGATAGAAGGGACAAGG + Intronic
958189398 3:90165593-90165615 CTCACATGGTAGAAGGCAGAGGG + Intergenic
958411706 3:93825202-93825224 CTCACATGGTGGAAGGCAGAGGG + Intergenic
958501845 3:94920995-94921017 CTCAAATGGTGGAAGGCAGAAGG - Intergenic
958577037 3:95964095-95964117 CTCAGATGGCAGAAGGTAGAAGG - Intergenic
958626631 3:96633278-96633300 CTCCTGTGGTAGAAGGGGCAAGG - Intergenic
958658581 3:97036006-97036028 CTCACAAGGCAGATGGGACAAGG - Intronic
959151681 3:102615939-102615961 CTCAAATGGTGGAAAGGGCAAGG + Intergenic
959214361 3:103431779-103431801 CTCATATGGCAGAAGGCAGAAGG + Intergenic
959224507 3:103562964-103562986 CTCACATGGTGGAAAGGGCAAGG - Intergenic
959508973 3:107188659-107188681 CTCACATGGTAGAAGGGGAGAGG + Intergenic
959518421 3:107297853-107297875 CTCACATGATGGAAGGGGCAAGG - Intergenic
959647531 3:108720641-108720663 CCCAAATGTTAGTAGGGTCATGG + Intergenic
959877044 3:111395371-111395393 TTCACATGGTGGAAGGGACAAGG - Intronic
959891680 3:111563057-111563079 CTCACATGGTGGAAGGCAGAAGG + Intronic
960241113 3:115343191-115343213 CTCACACGGCAGAAGGAACAAGG - Intergenic
960392348 3:117092934-117092956 CTCACATGGTGGAAGGCAGAAGG + Intronic
960461584 3:117942518-117942540 CTCACATGGTGGATGGGGCAAGG - Intergenic
960697746 3:120412415-120412437 CTCACATGGCAGAAGGCAGAAGG - Intronic
961703513 3:128765639-128765661 CTCACATGGTGGAAGGGGCGAGG + Intronic
961908529 3:130288787-130288809 CTCAAATGGTGGAGGAGGCAAGG - Intergenic
961925842 3:130479193-130479215 CTCACATGGTGGAAGGGAAGAGG - Intronic
962128491 3:132647914-132647936 CTCACATGGTGGAAGGGGCAAGG + Intronic
963010787 3:140768378-140768400 CTCACATGGTGGAAGGAGCAAGG - Intergenic
963335223 3:143967489-143967511 TTCGCATGGCAGAAGGGACAAGG - Intergenic
963462788 3:145638168-145638190 TTCACATGGTGGAAGGGGCAAGG - Intergenic
963645463 3:147908350-147908372 CTCACATGGTGGAAGGGGCAAGG - Intergenic
963713550 3:148776173-148776195 CTTACATGGTAGAAGGCAGAAGG - Intergenic
963908424 3:150793767-150793789 CTCACATGGTAGAAGGGCAGAGG - Intergenic
964165134 3:153695079-153695101 CTCACATGGCAGAAGGGAGAAGG - Intergenic
964309631 3:155378899-155378921 CTCACATGGCAGAAGGGGCGTGG + Intronic
964679345 3:159320292-159320314 CTCACATGGTGAAAGGGGCAAGG - Intronic
964843916 3:161025624-161025646 CTCACATGGTAGAAGATAGAAGG - Intronic
964899269 3:161638094-161638116 CTTAAATGTTAGAAGGAAGATGG + Intergenic
965138422 3:164804418-164804440 ATCACATGGTAAAAGGGAGAAGG - Intergenic
965211436 3:165794547-165794569 CTCACATAGTAGAAGGGAGAAGG + Intronic
965911019 3:173775703-173775725 ATTAAATGGAAGAATGGACATGG + Intronic
966001047 3:174949007-174949029 CTCACATGGCAGAAGAGAAAGGG + Intronic
966239731 3:177743121-177743143 CTTACATGGTGGAAGGGACAAGG + Intergenic
966453323 3:180086712-180086734 CTCAAATGGCAGAAAGTAGAAGG - Intergenic
966716649 3:183019460-183019482 CTCACGTGGTGGAAGGGACAAGG - Intronic
967508050 3:190276259-190276281 CTCATATGGTAGAAGGGATGAGG + Intergenic
967530014 3:190538337-190538359 CTCAAATGGTAGCATGCATAAGG - Intronic
967684071 3:192399306-192399328 TTCAAATGGCAGAAGGGGCAAGG - Intronic
967774916 3:193376337-193376359 CTCACATGGTAGAAGGGACAAGG + Intronic
967785209 3:193485773-193485795 CTCACATGGTGAAAGAGACAAGG - Intronic
968050956 3:195654653-195654675 CTCTGATGGAAGAAGAGACAGGG + Intergenic
968104869 3:195993685-195993707 CTCTGATGGAAGAAGAGACAGGG - Intergenic
968303164 3:197631269-197631291 CTCTGATGGAAGAAGAGACAGGG - Intergenic
969081370 4:4621180-4621202 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969172373 4:5374615-5374637 CTTAAGTGGTAGAAAGGGCAAGG + Intronic
969299003 4:6286352-6286374 CTCACAGGGTGGAAGGGGCAAGG - Intronic
969321052 4:6412854-6412876 CTCACATGGGGGAAGGGGCAAGG - Intronic
969355867 4:6625265-6625287 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969547113 4:7837400-7837422 CTCATGTGGCGGAAGGGACAAGG - Intronic
969965234 4:10987180-10987202 CTCATATGGTAGAAGGGGCAAGG - Intergenic
970113562 4:12667775-12667797 CTCACATGGTAGAAGAAACAAGG + Intergenic
970162723 4:13205365-13205387 CTCACATGGCAGAAGGGGCAGGG + Intergenic
970207533 4:13669837-13669859 CTCATGTGACAGAAGGGACAAGG + Intergenic
970550677 4:17177967-17177989 CTCACATGGAGGAAGGGGCAAGG + Intergenic
970559067 4:17265189-17265211 CTCACAAGGTGGAAGGGGCAAGG + Intergenic
970680657 4:18503899-18503921 CTCATATGGAAAAAGGGACTTGG - Intergenic
970726651 4:19053740-19053762 CTTACATGGTAGAAAGGGCAAGG - Intergenic
970732068 4:19117463-19117485 CTCACATAGCAGAAGGGACAAGG + Intergenic
970964562 4:21913397-21913419 CTCACATGGCAGAAGGCAGAAGG - Intronic
971047178 4:22817783-22817805 CTCATATGGCAGAAGGGGCCAGG - Intergenic
971112612 4:23605880-23605902 CTCACATGGTGGAAGGGACAAGG + Intergenic
971361960 4:25946405-25946427 CTCACATGGTGGAAGGCAGAAGG + Intergenic
971412696 4:26391989-26392011 CTCACATGGCAGGAGGGACAAGG + Intronic
971480541 4:27110735-27110757 CTCAGATAGTATAAGGGACAAGG - Intergenic
971504047 4:27347419-27347441 CTCATATGGCAGAAGGAGCAAGG + Intergenic
971520579 4:27545871-27545893 CTCACATGGCAGAAGGCAGAAGG + Intergenic
971592349 4:28484273-28484295 CTCACATGTTGGAAGGGTCAAGG - Intergenic
971597664 4:28552352-28552374 CTCAAATGGCAGAAAGCAGAAGG - Intergenic
971904205 4:32704966-32704988 CTTATATGGTAAAAGGGGCAAGG + Intergenic
972082498 4:35171414-35171436 TTTAAATGGCAGAAGGGACTTGG + Intergenic
972142310 4:35976096-35976118 CTCACATGGCAGAAGGGGCAAGG + Intronic
972161573 4:36234300-36234322 CTCACATGGCAGAAGGGCAAGGG + Intronic
972226146 4:37015127-37015149 CTCACATGGTGGAAGGAACAAGG - Intergenic
972236233 4:37137164-37137186 CTCGCATGGTAGAAGGCAGAAGG - Intergenic
972803755 4:42506303-42506325 CTCACATGGTAGAAGGGGCAAGG - Intronic
972914023 4:43853616-43853638 CTCACATGGTGGAAAGGACAAGG + Intergenic
972990453 4:44817206-44817228 CTCACATGGTGGAAGGGGCAAGG + Intergenic
973185810 4:47326660-47326682 CTTATATGGTGGAAGGGGCAAGG - Intronic
973199924 4:47488870-47488892 CTCCCATGGTGGAAGGGGCAAGG - Intronic
973627283 4:52785425-52785447 CTCACATGGCAGAAGGGGCCAGG - Intergenic
973801143 4:54480089-54480111 CTCACATGGTGGAAGAGACAAGG + Intergenic
973860174 4:55056080-55056102 CTCAAATGGTGGAAGAGACAAGG - Intergenic
974181910 4:58395415-58395437 CTCACATGGTGGAAGGGATGAGG + Intergenic
974469080 4:62295919-62295941 CTCACATGGTAGAAGGTGAAGGG + Intergenic
974610597 4:64210394-64210416 CTCACATGGTGGAAGGTAGAAGG - Intergenic
974658388 4:64854900-64854922 CTAACATGGTGGAAGGGGCAAGG + Intergenic
974677409 4:65111419-65111441 CTCACATGGCAGATGGGATAAGG - Intergenic
974757545 4:66230378-66230400 CTTACAGGGTGGAAGGGACAAGG + Intergenic
975028724 4:69585763-69585785 CTCACATGGTAGAAGTGGAATGG + Intergenic
975213206 4:71724709-71724731 CTCACATGGCAGGAGAGACAAGG + Intergenic
975409023 4:74026174-74026196 CTCACATGGTGGATGGGGCAAGG - Intergenic
975421862 4:74174101-74174123 CTCACATGGCAGAAGGCACAAGG + Intronic
975531831 4:75407466-75407488 CTCACATGGTGGAAGAGGCAAGG + Intergenic
975713927 4:77187689-77187711 CTCACATGGTAAAAGGAGCAGGG - Intronic
975740897 4:77427837-77427859 CTCACATGGCAGAAGGTAGAGGG + Intronic
975752411 4:77537681-77537703 CTCAAATGGATGCTGGGACATGG - Intronic
975923789 4:79424454-79424476 CTCACATGGTAGAAGGGATGAGG + Intergenic
976334697 4:83871822-83871844 CTCACATGGTAGAAGGGGCAAGG + Intergenic
976437342 4:85033292-85033314 ATCACATGGTAGAAGGCAGAAGG + Intergenic
976493870 4:85703584-85703606 CTCACATGGCAGAAGAGGCAAGG - Intronic
976513969 4:85943418-85943440 CTCAGATGGTGGAAGGTACAAGG + Intronic
976700108 4:87960380-87960402 CTCACTTGGTATAAGGGAGAAGG + Intergenic
977421311 4:96803318-96803340 CTCACATGGCAGAAGGGACAAGG - Intergenic
977437866 4:97022878-97022900 CTCACATGGTAGAAGTGAAAAGG - Intergenic
977490702 4:97706420-97706442 CTCACATGGCAGAAGGGCAAAGG - Intronic
977653976 4:99500966-99500988 TTCACATGGTGGAAGGGACAAGG + Intergenic
977748463 4:100579857-100579879 CTCACATGGCAGAAGGGGCAAGG - Intronic
977748600 4:100581002-100581024 CTCACATGGCAGAAGGAGCAAGG - Intronic
977756548 4:100678381-100678403 TTCACATGGCAGAAAGGACAAGG + Intronic
977880498 4:102198949-102198971 CTCACATGGCAGAAGGGATAAGG + Intergenic
977954360 4:103010303-103010325 CTCACATGGCAGAAGGTATAAGG + Intronic
978050347 4:104191107-104191129 CTCACATGGTAGAAGGGACAAGG + Intergenic
978365770 4:107979729-107979751 CTCACGTGATAGAAGGGACAAGG - Intergenic
978414128 4:108457709-108457731 CTCAAATGGTAGAAGGCAGAGGG - Intergenic
978494964 4:109348800-109348822 CTCACATGGTGGAAGGGGCAAGG - Intergenic
978696570 4:111587191-111587213 CTCACATGGTGGAAGGGTGAAGG + Intergenic
978865860 4:113510083-113510105 CTTAAATGGCAGAACTGACATGG - Intronic
978947211 4:114514740-114514762 CTCCAATGGTAAAAGGGGCAAGG - Intergenic
978964443 4:114724597-114724619 CTCACATGGCAGAAGGGAGGAGG - Intergenic
979174392 4:117644497-117644519 CTCACATGGCAGAAGGGGCAAGG + Intergenic
979366503 4:119830799-119830821 TTCACATGGTAGAAGGGGTAAGG - Intergenic
979418214 4:120469836-120469858 CTCACATGGCAGAAGGCAGAAGG - Intergenic
979763319 4:124434405-124434427 CTCAAATGATAGACGGGAACTGG + Intergenic
980033573 4:127857961-127857983 CCCAAAAGCTAGAAGGGACTGGG + Intergenic
980483042 4:133414308-133414330 CTCGCATGGTGAAAGGGACAAGG - Intergenic
980614584 4:135202325-135202347 CTCACATGGAGGAAGGGGCAAGG - Intergenic
980972149 4:139576794-139576816 CTCACATGGCAGAAGGGGTATGG + Intronic
981038743 4:140199921-140199943 CTCACATGGTGGAAGGGGTAAGG + Intergenic
981157141 4:141451807-141451829 CTTACATGGAAGAAGGGGCAGGG + Intergenic
981244010 4:142513370-142513392 CTCACATGGTAGGAGGGGCAAGG + Intronic
981274988 4:142888736-142888758 CTCACATGGCAGAAGGGGCAAGG - Intergenic
981535072 4:145791254-145791276 CTCACATGGCAGAAGAGGCAAGG + Intronic
982113458 4:152077090-152077112 CTCACATGGCAGAAGGGACCAGG - Intergenic
982219368 4:153111682-153111704 CTCACCTGGTAGAAGGGGCCAGG - Intergenic
982256363 4:153455200-153455222 CTCACATTGTAGAAGAGGCAAGG - Intergenic
982412263 4:155091934-155091956 CTCAAATGGTGGAAGGAAGAAGG - Intergenic
982617507 4:157658867-157658889 CTCACATGGTAGAAGAGGCCAGG + Intergenic
982656051 4:158151110-158151132 CTAAAATGGGCGAAGGGAAAGGG + Intronic
982709977 4:158748235-158748257 CTCACATGGTGGAAGGCAGAGGG - Intergenic
982743198 4:159079330-159079352 CTCACATGGTGGAAGGGGCAAGG - Intergenic
982951191 4:161698140-161698162 CTCACATGGCAGAAGGCAGAAGG - Intronic
982980507 4:162128457-162128479 CTCACATGGTGGAAGGGGCAAGG - Intronic
983477061 4:168226418-168226440 CTCACATGGTGGAAGGGGCAAGG - Intronic
983480150 4:168263654-168263676 CTCACATGGCAGAAGGGACAGGG - Intronic
983656294 4:170088842-170088864 CTCACGTGGCAGAAGGGCCAAGG - Intronic
983849687 4:172565084-172565106 CTCACATGGAAGAAGGGGCAAGG + Intronic
983972741 4:173894487-173894509 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984045727 4:174796180-174796202 CTCACATGGTGGAAGGGGCAAGG - Intronic
984176903 4:176430308-176430330 CTCACCTGGCAGAAGGGAAAAGG - Intergenic
984399519 4:179243907-179243929 CTCACATGGTAGGAGGGAAGAGG + Intergenic
984435962 4:179710427-179710449 CTCACATGGCAGAAGGGGCAAGG + Intergenic
984863383 4:184259180-184259202 CTCACATGGCAGAAGGGGCAAGG - Intergenic
984900647 4:184583223-184583245 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984983194 4:185302621-185302643 CTCACATGGCAGAAGGTGCAAGG - Intronic
985254738 4:188058480-188058502 CTCACATGGCAGAAGGCAGAAGG + Intergenic
986164764 5:5264050-5264072 CTCAGTTGGTAGAGGGGAGATGG - Intronic
986174296 5:5338892-5338914 CTCACATGGCCGAAGGGGCAAGG - Intergenic
986374667 5:7117819-7117841 CTCAGATAGCAGAAGGAACAAGG - Intergenic
986867980 5:12012574-12012596 CTCACATGGTGGAAGGGAAGAGG - Intergenic
987571062 5:19659709-19659731 CTCACATGGCAGAAGGCAGAAGG - Intronic
987700352 5:21390173-21390195 CTCACATGGCAGAAGGGGCAAGG - Intergenic
987824318 5:23008700-23008722 CTCACATGGGAGAAGGCAGAAGG - Intergenic
988752056 5:34197892-34197914 CTCACATGGCAGAAGGGTCAAGG + Intergenic
988821227 5:34888122-34888144 CTCACATGGTGGAAGGGGCAAGG - Intronic
988858139 5:35249065-35249087 CTCACATGGCAGAAGGAGCAAGG + Intergenic
989381335 5:40812368-40812390 CTCACATGGTAGAAGAGGTAAGG + Intergenic
989439768 5:41456731-41456753 CTCATATGGTGGAAGGGACAAGG - Intronic
989450134 5:41577229-41577251 TTCACATGGTGGAAGGGGCAAGG + Intergenic
989463229 5:41725261-41725283 GTCAAATGGTCAAAGGGACAGGG - Intergenic
989691245 5:44146952-44146974 CTCACATGGTAGAAGACAAAAGG - Intergenic
989980478 5:50637729-50637751 CTCACATGGTGGAAGGGACAAGG - Intergenic
990148644 5:52790745-52790767 CTTAGATGGTAAAAGGGACTTGG - Intronic
990377219 5:55183574-55183596 CTCACATGGTGGAAGTGACAAGG + Intergenic
990532043 5:56683814-56683836 TTCACATGGCAGAAGGGGCAAGG - Intergenic
990559256 5:56967153-56967175 CTCAAATGGTAGAAGGGACAAGG - Intronic
990700164 5:58466498-58466520 CTCACATGGTGGAAGGGGCAAGG - Intergenic
990755693 5:59066824-59066846 CTCACATGGTGGAAGGGGCAAGG - Intronic
990806224 5:59665804-59665826 CTCACTTGGAAGAAGGGGCAAGG - Intronic
991036655 5:62134407-62134429 CTCACATGGTGAAAGGGGCAAGG + Intergenic
991148812 5:63341216-63341238 CTCACATGGTATAAAGGACAAGG - Intergenic
991322084 5:65384979-65385001 TTCACATGGTAGAAGGCAAAAGG + Intronic
991349150 5:65702597-65702619 CTCACATGGCAAGAGGGACAGGG + Intronic
991357517 5:65784534-65784556 CTCACATGGCAGAAGGGGGAAGG + Intronic
991445254 5:66692777-66692799 CTCACTTGGTGGAAGGGGCAAGG + Intronic
991558252 5:67920842-67920864 CTCACATGGTGGAAGGGTAAAGG - Intergenic
991582814 5:68174466-68174488 CTCACATGGTGGAAGGGCAAGGG + Intergenic
991671348 5:69051271-69051293 CTCACATGGTGGAAGGGGCAAGG - Intergenic
991739821 5:69658708-69658730 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991757678 5:69894469-69894491 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991791396 5:70238449-70238471 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991819284 5:70534833-70534855 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991837081 5:70770351-70770373 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991883845 5:71238791-71238813 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991953712 5:71971732-71971754 CTCACATGGGGGAAGGGGCAGGG + Intergenic
992157934 5:73973074-73973096 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992388039 5:76304708-76304730 CTCACATGGTGGAAGGCAGAAGG + Intronic
992476278 5:77104502-77104524 CTCACATGGCAGAAGGCAGAAGG - Intergenic
992485924 5:77195200-77195222 CTCACATGGCAGAAGGCAGAAGG + Intergenic
993309138 5:86307061-86307083 CTCACACGGTAGAAGGGGCTAGG + Intergenic
993488423 5:88515470-88515492 CTCACATGGTATAAGGAACAAGG + Intergenic
993978354 5:94511092-94511114 CTCATGTGGTAGAAGGGGCAAGG - Intronic
994076738 5:95660223-95660245 CTCATATGGTGGAAGAAACAAGG + Intronic
994260713 5:97655421-97655443 CTCACGTGGCAGAAGGGACAAGG - Intergenic
994448104 5:99903591-99903613 CTCATATGGGAGAAGGTATAAGG - Intergenic
994663193 5:102677347-102677369 CTCACATGGTGAAAGGGGCAAGG - Intergenic
994949919 5:106448528-106448550 CTCACATGGTGGAAGGCAGAAGG - Intergenic
995020025 5:107356097-107356119 CTCTAATGGTAGTAGGAACATGG - Intergenic
995058582 5:107789314-107789336 CTCACATGGTGGAAGGGACAAGG - Intergenic
995126496 5:108581884-108581906 CTCATGTGGTGGAAGGGGCAAGG + Intergenic
995593058 5:113719787-113719809 CTCACATGGCAGAAGGTAAAAGG - Intergenic
996214019 5:120845872-120845894 CTCACATGGTGGAAGGTAAAGGG - Intergenic
996294112 5:121890940-121890962 CTCAGTTGGTAGAAGGGAAGTGG - Intergenic
997107835 5:131041533-131041555 CTCACATGGTAGAAAGGGCAAGG - Intergenic
997559956 5:134837636-134837658 CTCACATGGCAGAAGGGGCAAGG - Intronic
997909389 5:137854963-137854985 CTCACATGGTAGAAGGGGCAAGG - Intergenic
998766269 5:145491292-145491314 CTCACATGGTGGAAGGGCCAAGG + Intronic
999288625 5:150408890-150408912 CTCATATGGTGGAAGGCAGAAGG - Intronic
999853260 5:155565564-155565586 CTCAAATGGTGGAGATGACAAGG - Intergenic
999869296 5:155732471-155732493 CTCAAATGGTAGAGTGGGGAGGG - Intergenic
999897853 5:156053892-156053914 CCCACATGGTGGAAGGGGCAAGG + Intronic
1000013603 5:157257439-157257461 CTCATATGGCAGAAGGGTAAAGG - Intergenic
1000423410 5:161062620-161062642 CTCACATGGCGGAAGGGGCAAGG - Intergenic
1000699472 5:164430402-164430424 CTCTCATGGTAGAAGGCAAAGGG - Intergenic
1000777423 5:165438366-165438388 CTCAAATGGGAGAAGACAAATGG - Intergenic
1000884440 5:166735243-166735265 GTCAAATGGTAGAGGTGAAAAGG + Intergenic
1001117276 5:168950201-168950223 CTCACATGGAGGAAGGGACAAGG - Intronic
1001441587 5:171747941-171747963 TTCTCATGGTAGAAGGGACAAGG + Intergenic
1002579932 5:180201816-180201838 CTCACATGGAGGAAGGGACAAGG - Intronic
1002592136 5:180298174-180298196 CTCACATGGCAGAAGGGACAAGG - Intergenic
1002622871 5:180501755-180501777 TTGAAATGGTTGAAGAGACAAGG + Intronic
1003251274 6:4430967-4430989 CTCACATGGTGGAAGAGGCAAGG - Intergenic
1003692056 6:8364724-8364746 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1003692064 6:8364772-8364794 CTCATATGGAAGAAGGGGCAAGG - Intergenic
1003692070 6:8364807-8364829 CTCATACGGAAGAAGGGGCAAGG - Intergenic
1003864040 6:10347557-10347579 CTCACATGGTGGAAAGGGCAAGG + Intergenic
1003877041 6:10447080-10447102 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1004072108 6:12309216-12309238 CTCCCATGGTAGAAGGCTCAGGG - Intergenic
1004271569 6:14200730-14200752 CTCACATGGTGGAAGGGACGAGG + Intergenic
1004299003 6:14440244-14440266 CTCAAATGGTAGTAGGGTGGTGG + Intergenic
1004371763 6:15058943-15058965 CTCAAATGTCAGAAGGAGCAAGG + Intergenic
1004472072 6:15938414-15938436 CTAACATGGTAGAAAGGGCAAGG - Intergenic
1004522674 6:16377083-16377105 CTCACATGGTGGAAGGAGCAAGG - Intronic
1005214518 6:23509605-23509627 CTCACATGGAGGAAGGGAAAGGG - Intergenic
1005380477 6:25229270-25229292 CTCCAATGGGAGAAGGGACAAGG - Intergenic
1005550217 6:26904606-26904628 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1005901959 6:30224383-30224405 TTCACATGGTGGAAGAGACAAGG - Intergenic
1005904882 6:30253590-30253612 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1005931916 6:30490585-30490607 CTCAAACAGTAGAAGAAACAGGG + Intronic
1006613171 6:35307644-35307666 CTCAAATGGCTTAAGGGAGAGGG + Intronic
1007116445 6:39346405-39346427 CTCACATGGTGGAAGGGGCAAGG - Intronic
1007295913 6:40820388-40820410 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1008158507 6:48047728-48047750 CTCACATGATAGAAGGGGCAAGG - Intronic
1008417859 6:51264224-51264246 TTCACATGGTAGAAGGGAGGCGG - Intergenic
1008523923 6:52388577-52388599 CTCACATGGCAGAAGAGGCAAGG - Intronic
1008614808 6:53216465-53216487 CTCACATGGCAGAAGGGGCAGGG - Intergenic
1008668236 6:53738759-53738781 CTCACATGGTGGAAGGGGAAAGG + Intergenic
1009336902 6:62502325-62502347 CTCACATGGTAGAAGGGGCGAGG - Intergenic
1009338706 6:62526913-62526935 CTCATATGGTGGAAGGGGCAAGG - Intergenic
1009763128 6:68034811-68034833 CTCACATGGTGGAAGGGAGAAGG - Intergenic
1009811989 6:68680032-68680054 CTCACATAGTGAAAGGGACAGGG - Intronic
1009845168 6:69125490-69125512 TTCACATGGCAGAAGGGGCAAGG - Intronic
1010162973 6:72880346-72880368 CTCACATGGTGGAAGGGGCGAGG + Intronic
1010247451 6:73674777-73674799 TTCACATGATAGAAGGGGCAAGG - Intergenic
1010588644 6:77686103-77686125 CACTCATGGTAGAAGGCACAGGG - Intergenic
1010628309 6:78166588-78166610 CTCACATGAAAGAAGGGATAAGG + Intergenic
1010731026 6:79391512-79391534 CTCACATGATGGAAGGGGCAAGG + Intergenic
1010986965 6:82435696-82435718 CTCACATGGTGGAAGGAGCAAGG - Intergenic
1011003956 6:82622879-82622901 CTCACATGGTAGAAGGGATGAGG - Intergenic
1011352803 6:86441162-86441184 CTCACATAGTAGAAGGGGCAGGG - Intergenic
1011574916 6:88786940-88786962 CCCACATGGCAGAAGGGGCAAGG - Intronic
1011756101 6:90499644-90499666 CTCACATGGTACAAGGGTGAGGG + Intergenic
1011890328 6:92151244-92151266 CTCATATGGCAGAAGAGGCAAGG + Intergenic
1012175736 6:96080650-96080672 TTGAAATGGAAGAAGGTACATGG - Intronic
1012443227 6:99281664-99281686 CTCACATGGTAAAAGGGGGAAGG - Intronic
1012448247 6:99328359-99328381 CTCATATGGTGGAAGGGCCAAGG - Intronic
1012599618 6:101079063-101079085 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1012874268 6:104707693-104707715 CTCAAATGGTAGAAGGTAGAAGG + Intergenic
1012926622 6:105274274-105274296 CTCACATGGTGGAAGGGATGGGG + Intergenic
1013594111 6:111645570-111645592 CTCACCTGGTAGAAGGGAAGAGG - Intergenic
1013675694 6:112459389-112459411 CTCATATGGTAGAAGGGACAAGG - Intergenic
1013693299 6:112670321-112670343 CTCACATGGTGAAAGGGGCAAGG + Intergenic
1013754337 6:113443361-113443383 CTCACATGGTGGGAGGGCCAAGG - Intergenic
1013786712 6:113789448-113789470 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1014008132 6:116444707-116444729 CTCACATGTTGGAAGGGACAAGG - Intergenic
1014009027 6:116455723-116455745 TTCACATGGTGGAAGAGACAAGG - Intergenic
1014127099 6:117789325-117789347 CTCACATGGTGGAAGGGTGAAGG + Intergenic
1014503620 6:122225800-122225822 CTCACATGGTGGAAGGCAGAAGG + Intergenic
1014775907 6:125509625-125509647 CTCACGTGGTGGAAGGGGCAGGG - Intergenic
1014808942 6:125863799-125863821 CTCACATGGTAGAAGGGTGAGGG + Intronic
1015010105 6:128335494-128335516 CTCAAGTAGTAGAAGGAAAAAGG + Intronic
1015169889 6:130240761-130240783 CTCACATGGTGGAAGGGCAAGGG - Intronic
1015187093 6:130430219-130430241 CTCACATGGTAGAAGGGGGAAGG + Intronic
1015210112 6:130687249-130687271 CTCACATGGCAGAAGGCACCAGG + Intergenic
1015797249 6:137025316-137025338 CTCACATGTTGGAAGGGGCAAGG - Intronic
1015971755 6:138749359-138749381 CTCATATGACAGAAGGAACAAGG - Intergenic
1016029292 6:139321333-139321355 TTCATATGGTAGAAGGCACAAGG - Intergenic
1016029403 6:139322312-139322334 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1016253948 6:142081126-142081148 TTCAAATGGTGGAAGGGTCAAGG + Intronic
1016463578 6:144303993-144304015 CTTAAGTGGTAGAAGGGCCCTGG + Intronic
1016587536 6:145706991-145707013 CTCACATGGCAGAGGGGAAAAGG - Intronic
1016753454 6:147657732-147657754 CTCACATGGTAGAAGGGGCATGG + Intronic
1016881321 6:148915022-148915044 CTCACATGGTGGAGGGGGCATGG + Intronic
1016904640 6:149136765-149136787 CTCACATGGCAGAAGGGGAAGGG + Intergenic
1017054231 6:150423698-150423720 CCCGCATGGTAGAAGGGGCAGGG + Intergenic
1017187488 6:151616810-151616832 CTCACATGGTGGAAGGAGCAAGG + Intronic
1017192374 6:151668237-151668259 CTCATATGGCAGAAGGTAGAAGG + Intronic
1017282706 6:152640729-152640751 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1017284273 6:152656596-152656618 CTCACATGATGGTAGGGACAAGG + Intergenic
1017346763 6:153391854-153391876 CTCATGTGGTGGAAGGGGCAAGG - Intergenic
1017371471 6:153714232-153714254 CTCACATGGGGGAAAGGACAAGG + Intergenic
1017852349 6:158315797-158315819 CTCACATGGTGGAAGGGGCAAGG + Intronic
1017904274 6:158746089-158746111 CTCCCATGGTAGAAGGGACAAGG + Intronic
1018127018 6:160691637-160691659 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1018149540 6:160925443-160925465 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1018154071 6:160969253-160969275 CTCACCTGGTAGAAGGGGTAAGG - Intergenic
1018338139 6:162818150-162818172 CCCAAATGTTAGAGGGGTCAAGG - Intronic
1018520573 6:164645655-164645677 CTCACATGGTGGAAGGGCCAAGG - Intergenic
1018756730 6:166856314-166856336 CTCACGTGGTGGAAGGGGCAAGG - Intronic
1019068743 6:169324495-169324517 CTTACATGGTGGAAGGGACAAGG + Intergenic
1020187791 7:5972072-5972094 CTCACGTGGCAGAAGGGACTCGG - Intergenic
1020220628 7:6233931-6233953 CTCACTTGGTGGAAGGGGCAAGG + Intronic
1020295125 7:6752698-6752720 CTCACGTGGCAGAAGGGACTCGG + Intergenic
1021018563 7:15566976-15566998 TTCAAATTGTGGAAGGGACCTGG - Intergenic
1021367734 7:19801660-19801682 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1021487965 7:21187707-21187729 CCTACATGGTAGAAGGGGCAAGG - Intergenic
1021863656 7:24932591-24932613 CTCACAGGGTGGAAGGGACAAGG - Intronic
1021976935 7:26020216-26020238 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1022767615 7:33431565-33431587 CCCACATGGTAAAAGGGGCAAGG - Intronic
1022809642 7:33856278-33856300 CTCAGATGGTACAAGAGGCAAGG - Intergenic
1023235958 7:38087504-38087526 CTCACATGGTAGAATTGGCAAGG - Intergenic
1023384999 7:39647728-39647750 CTCACATGGTGGAAGGAGCAAGG - Intronic
1023823347 7:43992272-43992294 CTCATATGGTGGAAGGGTCAAGG + Intergenic
1023961394 7:44929599-44929621 CTCACATGGTGGAAGGGATGAGG + Intergenic
1024009098 7:45252608-45252630 CTCACATGATGGAGGGGACAAGG + Intergenic
1024196304 7:47062253-47062275 CTCACGTGGTGGAAGGGGCAAGG - Intergenic
1024259048 7:47560258-47560280 CTCACATGGTAGAGGGGTGAGGG - Intronic
1024338994 7:48238150-48238172 CTCACGTGGTAGAAGGGGTAAGG + Intronic
1024617682 7:51129305-51129327 CTCACATGGTGGAAGGGGCGGGG + Intronic
1024707589 7:51977776-51977798 CTCAAATGTTAGTAGCGTCAAGG + Intergenic
1024964647 7:55013193-55013215 CTCACATGGCAGAAGGACCAAGG - Intergenic
1025300613 7:57817229-57817251 CTCACATGGTAGAAGGTGGAAGG - Intergenic
1026678251 7:72446413-72446435 CTCAAAAGGCACAAGGGACAGGG + Intronic
1026884764 7:73933699-73933721 CTCAAATGGCAGAAAGGGGAGGG + Intergenic
1027154864 7:75759708-75759730 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1027389566 7:77691694-77691716 CTCACATGGTAGAAGGCAGCAGG - Intergenic
1027602294 7:80254269-80254291 TTCATATGGTATAAGGGGCAAGG - Intergenic
1027950495 7:84808955-84808977 CTCACATGGCAGAAGGGACCAGG + Intergenic
1028603347 7:92627460-92627482 TTCATATGGTGAAAGGGACAAGG - Intronic
1028766766 7:94568795-94568817 CACACATGGTGGAAGGGGCAAGG - Intergenic
1028882379 7:95894330-95894352 CTGATATGATAGAAGGGGCAAGG + Intronic
1029054008 7:97721110-97721132 CTCACATAGTGGAAGAGACAAGG + Intergenic
1029502370 7:100939881-100939903 TTCACATGGTAGAAGGGCAAGGG - Intergenic
1029751607 7:102545724-102545746 CTCATATGGTGGAAGGGTCAAGG + Intronic
1029769560 7:102644815-102644837 CTCATATGGTGGAAGGGTCAAGG + Intronic
1029859019 7:103549314-103549336 CTCACATGGTGGAAGAGGCAAGG + Intronic
1030203449 7:106929063-106929085 CTCACATGGCAGAAGGGACAAGG + Intergenic
1030206300 7:106955368-106955390 CTCATATGACAGAAGGGGCAAGG - Intergenic
1030225837 7:107149500-107149522 CTCACATGGTGGAAGGGGCAAGG + Intronic
1030353177 7:108512975-108512997 CTTAGATGGCAGAAGGGGCAAGG - Intronic
1030662364 7:112234403-112234425 TTTACATGGCAGAAGGGACAAGG + Intronic
1030874802 7:114800551-114800573 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1031020240 7:116620120-116620142 CTCACATGATGGAAGGAACAGGG + Intergenic
1031123661 7:117748916-117748938 CTCAAGTGGTGGAAGGGGCAAGG - Intronic
1031521599 7:122773193-122773215 ATTAAATGCTAGAAAGGACACGG + Intronic
1031555885 7:123175554-123175576 CTCACATGATGGAAGGGGCAAGG - Intronic
1031681057 7:124675203-124675225 CTCATATGGTGGAAGGGGCAAGG - Intergenic
1031847085 7:126818957-126818979 CTCAGAAGGTGGAAGTGACAGGG - Intronic
1032932082 7:136684499-136684521 CTTACATGGAAGAAGGGGCAAGG + Intergenic
1033040085 7:137909653-137909675 CTCCATTGGAAGAAGGGACAAGG - Intronic
1033168954 7:139066496-139066518 TACAAAGGGTGGAAGGGACAAGG + Intronic
1033237716 7:139651206-139651228 CTAAAAAGGTAGGAGGCACAAGG + Intronic
1033366524 7:140676207-140676229 ATCACATGGTAGAAGGGGTAAGG + Intronic
1033639293 7:143245746-143245768 CTCATGTGGTAGAAAGGACAGGG - Intronic
1033848429 7:145463510-145463532 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1033980217 7:147155214-147155236 CTCACATGGCAGAAGGCTCAAGG - Intronic
1034278741 7:149837292-149837314 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1034363675 7:150525278-150525300 CTCACATGGTGAAAGGGACAAGG + Intergenic
1034642769 7:152617943-152617965 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1034684986 7:152962574-152962596 CTGACATGGAAGAAGGTACATGG - Intergenic
1034688472 7:152994943-152994965 CTCACATGATGGAAGGGATATGG - Intergenic
1034872090 7:154694124-154694146 CTCGCTTGGTGGAAGGGACAAGG + Intronic
1034888934 7:154822360-154822382 CTCACATGGTGGAAGGGGCAAGG + Intronic
1034922211 7:155092756-155092778 CTCACATGGCAGAAGGCAAAGGG - Intergenic
1034999910 7:155604282-155604304 CTTACATGGCAGAAGGGACGTGG + Intergenic
1035897735 8:3422904-3422926 CTCACATGGCAGAAGGAAAAGGG + Intronic
1036161797 8:6395879-6395901 CTCACATGGCAGAAGGGACAAGG + Intergenic
1036436067 8:8734604-8734626 CTCACATGGTGGGAGGGGCAGGG - Intergenic
1036493250 8:9247175-9247197 CTCAAATGGCAAAAGGGACTTGG - Intergenic
1036575752 8:10026406-10026428 CACAAATGGGAGATGGGAAATGG - Intergenic
1037148203 8:15600100-15600122 AACAAGTGGTAGAGGGGACATGG + Intronic
1037586912 8:20283337-20283359 TTCAGATGGTGGAAGGGACAAGG - Intronic
1037626802 8:20615262-20615284 CTCACAGAGTGGAAGGGACAAGG + Intergenic
1037728204 8:21501474-21501496 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1038282771 8:26180967-26180989 CTCACCTGGTGGAAGGGCCAAGG - Intergenic
1038298249 8:26316738-26316760 TTGACATGATAGAAGGGACAAGG + Intronic
1038348043 8:26750158-26750180 CTCAGATAGCAGAAGGGACAAGG + Intronic
1038381272 8:27096605-27096627 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1039094010 8:33863856-33863878 CTCACATGGTGGAAGAGGCAAGG - Intergenic
1039099745 8:33928488-33928510 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1039192170 8:34988630-34988652 CTTACATGGTAGAAGAGACAAGG + Intergenic
1039307177 8:36275261-36275283 CTCACATGGTAGACGGGCAAGGG + Intergenic
1039705782 8:40005992-40006014 CTCACATAGTGGAAGGGACAAGG - Intronic
1039722967 8:40184662-40184684 CTCACATGGTGGAAAGGGCAAGG - Intergenic
1040071813 8:43194815-43194837 CTCACATGGTAGAAGAGGCAAGG - Intronic
1040433644 8:47368115-47368137 CTCACATGGTGGAAGGGACAAGG + Intronic
1040539773 8:48342142-48342164 CTCACTTGGTAGAAGGGGAAAGG - Intergenic
1040655512 8:49502981-49503003 CTCACATGGTAGGAAGGGCAAGG - Intergenic
1040673242 8:49717616-49717638 CTCACATGGCAGATGGGGCAAGG - Intergenic
1041036790 8:53799800-53799822 CTCAGATGGCAGAGGGGACAGGG - Intronic
1041258213 8:55997492-55997514 CTCACGTGGTGGAAGGGGCAAGG + Intronic
1041422893 8:57689353-57689375 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1041454716 8:58045956-58045978 TTCACAAGGCAGAAGGGACAAGG + Intronic
1041661017 8:60401285-60401307 CTCAAATTTTACAAAGGACAAGG + Intergenic
1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG + Intergenic
1041862403 8:62529550-62529572 CTCATATGGTGGAAGGGGGAAGG - Intronic
1041925460 8:63231325-63231347 CTCATATGGTGAAAGGGACAAGG + Intergenic
1042352473 8:67791382-67791404 CTCACATGGTTGAAGGAACTAGG - Intergenic
1042400347 8:68338157-68338179 CTCATATGGCAGAAGGCAGAAGG + Intronic
1042411413 8:68470746-68470768 CTCACATGGTGGAAGGGGCAAGG + Intronic
1042449510 8:68928266-68928288 CTCACATGGAAGAAGGCAGAAGG - Intergenic
1042775886 8:72430815-72430837 CTCACATGGTGGAAGGCAGAAGG + Intergenic
1042870200 8:73391139-73391161 CTCACATGGTGAAAGGGGCAAGG - Intergenic
1043011649 8:74888506-74888528 CTTACATGGTGGAAGGGGCAAGG + Intergenic
1043337821 8:79198980-79199002 CTCACATGGTAGAAGGGATGAGG + Intergenic
1043350800 8:79359049-79359071 CTCACATGGTGGCAGGGACTGGG - Intergenic
1043940207 8:86188545-86188567 CTCACATGGTGGAAGTGCCAAGG + Intergenic
1044076940 8:87833423-87833445 CTCACATGGTGGAAAGGGCAAGG - Intergenic
1044348161 8:91130886-91130908 CTCACATGGTAGAAGGGGCAAGG + Intronic
1044415560 8:91935343-91935365 CTCACATGGTGAAAGGGGCATGG + Intergenic
1044510635 8:93074344-93074366 CTCACATGGTAGAGGGGGCAAGG - Intergenic
1044639605 8:94364981-94365003 CTCACATGGTGGAAGGGACAAGG - Intergenic
1044725670 8:95192443-95192465 CCAACATGGTAGAAGGGACTAGG - Intergenic
1045859772 8:106803102-106803124 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1046177190 8:110593172-110593194 CTCACATGGTAGAAGAGGCAAGG + Intergenic
1046416639 8:113923671-113923693 TTCACATGGTAGAAGGCAAAAGG - Intergenic
1046953378 8:120039185-120039207 CTCACATGGTAGAAGGGGCAAGG - Intronic
1047014641 8:120710653-120710675 CTCACATGGCAGAAGGCAGAAGG - Intronic
1047145352 8:122192667-122192689 CTCACATGATAGAAGGGTGAGGG + Intergenic
1047778946 8:128096422-128096444 CTCAGCTGGTACAGGGGACAGGG - Intergenic
1048465556 8:134662154-134662176 CTCACATGGTGGAAGGGGCAAGG + Intronic
1048476707 8:134749449-134749471 TTCACATGGTAGAAGGGGCAAGG + Intergenic
1048635121 8:136287055-136287077 CTCACATGTGTGAAGGGACAAGG - Intergenic
1048908046 8:139107279-139107301 CTTAAATGGTGGAAGGGACAGGG + Intergenic
1049111095 8:140643982-140644004 CTCATATGGTAGAAGGGGCAAGG - Intergenic
1050093659 9:2041430-2041452 CTCACATGGCAGAAGAGACAAGG + Intronic
1050103939 9:2146194-2146216 CTCACATGGTAGAAGGGACATGG + Intronic
1050367277 9:4884264-4884286 CTCACATGGTAGAAGGGGTCTGG + Intronic
1050759681 9:9052159-9052181 CCCACATGGCAGAAGGGGCAAGG + Intronic
1050987874 9:12105664-12105686 CCCTAAAGCTAGAAGGGACAGGG + Intergenic
1050990954 9:12151310-12151332 TTCACATGGAAGAAGGGAAAAGG + Intergenic
1051062148 9:13056933-13056955 CTCACATGCTGGAAGGGACAAGG + Intergenic
1051066070 9:13104554-13104576 CTCAAAAGCTGGAAGAGACAAGG - Intergenic
1051266735 9:15316511-15316533 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1051277281 9:15408946-15408968 TTCACCTGGTGGAAGGGACAAGG + Intergenic
1051602210 9:18886644-18886666 CCCACATGGTGGAAGGGCCAAGG + Intronic
1051662681 9:19440494-19440516 CTCACATGGTAGAAGGGCCAAGG - Intronic
1051910703 9:22152190-22152212 CTCACATAGTAGAAGGGGCAAGG - Intergenic
1051964839 9:22815276-22815298 CTCACATGGTAGAAGGCAGAGGG - Intergenic
1051969073 9:22864879-22864901 CTCACACAGTTGAAGGGACAAGG + Intergenic
1052046974 9:23805311-23805333 CTCAAATGGTAGACTTGAAAGGG - Intronic
1052083413 9:24234778-24234800 CTCACATGGTGAAAGGGACAAGG + Intergenic
1052234350 9:26191989-26192011 CTCACATAGTGGCAGGGACAAGG - Intergenic
1052378733 9:27746138-27746160 CTCACATGGTGGAAGGAACAAGG - Intergenic
1052419425 9:28223339-28223361 CTCACATGGAAGAAGGCATAAGG + Intronic
1052621040 9:30910754-30910776 CTGACATAGTAGGAGGGACAAGG - Intergenic
1054702237 9:68424406-68424428 CTCACATGGTGGAAGGGGCAAGG + Intronic
1054869431 9:70035801-70035823 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1055390362 9:75815278-75815300 CTTACATAGTGGAAGGGACAAGG + Intergenic
1055618206 9:78095105-78095127 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1056423335 9:86451786-86451808 CTCAAATGGCAGAAGGTAGAAGG + Intergenic
1056423476 9:86453174-86453196 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1056594749 9:87997780-87997802 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1056987127 9:91373664-91373686 CTCACATGATAGAAGGGGCAGGG + Intergenic
1057468758 9:95339091-95339113 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1058078600 9:100676595-100676617 CTCACGTGGTGGAAGGGGCAAGG + Intergenic
1058188424 9:101883896-101883918 CTCAAATGGTAGAAGGGGCAAGG - Intergenic
1058940342 9:109807522-109807544 TTCACATGGTGGAAGGGGCAAGG + Intronic
1059133912 9:111784814-111784836 CTCACATGGCAGAAAGGTCAAGG + Intronic
1059465151 9:114464459-114464481 CTCACATGGTGGAAGGGGCGAGG + Intronic
1059489470 9:114655246-114655268 CTCACATAGCAGAAGGGGCAAGG - Intergenic
1059502680 9:114768473-114768495 CTCACATGGTAAAAGGGACAAGG - Intergenic
1059584412 9:115590630-115590652 TTCAAAGGGTACAGGGGACAAGG - Intergenic
1059599645 9:115762879-115762901 CTCACATGGTAGAAGGCAGAAGG + Intergenic
1059822466 9:117989184-117989206 CTCACATGGTGAAAAGGACAAGG + Intergenic
1059898072 9:118890943-118890965 CTCATGTGTTGGAAGGGACAAGG - Intergenic
1059921060 9:119160209-119160231 CTCACATGGTGGAAGGGGCAAGG - Intronic
1060500379 9:124149267-124149289 CTCACATGGTGGAAGGGGCGAGG + Intergenic
1060607772 9:124932835-124932857 CTCACATGGTGGAAGGGGCAAGG + Intronic
1185637646 X:1564843-1564865 CTCACATGGTGGAAGGGGCCAGG - Intergenic
1185676783 X:1855818-1855840 CTCACATGGTGGAAGAGACGAGG + Intergenic
1185676810 X:1855972-1855994 CTCACATGGTGGAAGAGACGAGG + Intergenic
1185676837 X:1856126-1856148 CTCACATGGTGGAAGAGACGAGG + Intergenic
1185676851 X:1856203-1856225 CTCACATGGTGGAAGAGACGAGG + Intergenic
1185676865 X:1856280-1856302 CTCACATGGTGGAAGAGACGAGG + Intergenic
1185827381 X:3264902-3264924 CTCACACGGTGGAAGGGGCAAGG - Intergenic
1185828584 X:3276623-3276645 CTCACATGGTAGAAGGGGCAAGG - Intronic
1185842598 X:3406523-3406545 CTCACATGGTGGAAGGGGCGAGG - Intergenic
1185842780 X:3408527-3408549 CTCACATGGTGGAAGGGGCGAGG + Intergenic
1185845325 X:3432503-3432525 CCCACATGGTGGAAGGGACAAGG + Intergenic
1185847086 X:3447736-3447758 CCAAGATGGCAGAAGGGACACGG + Intergenic
1185848414 X:3462389-3462411 TTCAAATGGTGGAAGGGGCGAGG + Intergenic
1185869675 X:3653250-3653272 CTCACATGGTGGAAGGGGCGAGG - Intronic
1185938509 X:4286001-4286023 CTCACATGGAGGAAGGGGCAAGG - Intergenic
1185969010 X:4641010-4641032 CTCACATGCTGGAAGGGACGAGG - Intergenic
1186027014 X:5324270-5324292 CTCACATGGTGGAAGGGGTAAGG - Intergenic
1186035915 X:5423534-5423556 CTCACGTGGTAGAAGGGGCAAGG - Intergenic
1186054866 X:5639400-5639422 CTCACATGGTGGAAGGGACAAGG - Intergenic
1186066800 X:5775275-5775297 CTCACATGGTGGAAGGGGCCAGG + Intergenic
1186082788 X:5951693-5951715 CTCACATGATAAAAGGGACGAGG + Intronic
1186096825 X:6111324-6111346 CTCACATGTTGGAAGGGACAAGG - Intronic
1186146222 X:6626964-6626986 CTCACATAGTAGAAGGGGTAAGG + Intergenic
1186170551 X:6872016-6872038 CTCACATGGTGGAAGGGGAAAGG + Intergenic
1186174513 X:6910908-6910930 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1186268394 X:7857782-7857804 CTCACAGGGTGGAAGGGGCAAGG + Intergenic
1186275316 X:7931982-7932004 CTCACATGGTGGAAGGGGCAAGG + Intergenic
1186281571 X:7998796-7998818 CTCACATGGTGGAAGGGGCAAGG - Intergenic
1186695209 X:12023135-12023157 CTCATATGGTAGAAGGGATGAGG - Intergenic
1186963465 X:14762137-14762159 CTCACATGGTGGAAGGCAGATGG + Intergenic
1186987054 X:15028482-15028504 CTCATATGGTGGAAGGAGCAAGG - Intergenic
1186988168 X:15038734-15038756 CTCACATGGTGGAATGGGCAAGG - Intergenic
1187043179 X:15618199-15618221 CCCAAATGGTGGAAGGGGAAGGG + Intergenic
1187221243 X:17328162-17328184 CTCACATGGTAGAAAGAGCAAGG + Intergenic
1187316710 X:18202515-18202537 CTCACATGGCAGAAGGTAGAAGG - Intronic
1187426228 X:19179860-19179882 CTCACATGGCATAAGGGGCAGGG - Intergenic
1187446165 X:19363252-19363274 CTCACATGGTGGAAGGGATGAGG - Intronic
1187471589 X:19574564-19574586 CTCACGTGGTGGAAGGGAGAGGG + Intronic
1187618969 X:21029561-21029583 CTTGCATGGTCGAAGGGACAAGG + Intergenic
1187699112 X:21947686-21947708 TTTAAATGGGAAAAGGGACAGGG - Intronic
1187762067 X:22598314-22598336 TTCACATGGTGGAAGGGACAAGG - Intergenic
1187974577 X:24692430-24692452 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1188172401 X:26943636-26943658 CTCACATGGTAGAAAGGGCAAGG - Intergenic
1188293515 X:28417571-28417593 CTCACATGGCAGAAGGGGCGAGG + Intergenic
1188678214 X:32969071-32969093 CTCACATGGTGGAGGGGAAAGGG - Intronic
1188746445 X:33850640-33850662 CTCACATGTCAGAAGGGGCAAGG + Intergenic
1188840754 X:35014146-35014168 TGCACATGGTAGAAGGGGCAGGG - Intergenic
1189347990 X:40256921-40256943 CTAAAATGGTAGAAAGGGCCAGG - Intergenic
1189385945 X:40536993-40537015 CTCACATGGCAGAAAGGGCAAGG - Intergenic
1189447145 X:41090821-41090843 CTCAAACACTAGAAGAGACAGGG + Intronic
1189489323 X:41457342-41457364 CTCATGTGGTAGAAAGGGCAAGG - Intronic
1189569757 X:42283933-42283955 CTCACATGGCAGAAGGAGCAAGG - Intergenic
1189668678 X:43384630-43384652 CTCACATGGCACAAGGGGCAAGG - Intergenic
1189916163 X:45857749-45857771 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1190164025 X:48056706-48056728 CTCACATGGCAGAAGGCAGAAGG - Intronic
1190211781 X:48454558-48454580 CTCATATGGCAGAAGGCAGAAGG - Intergenic
1190242422 X:48667843-48667865 CTCACATAGTGGAAGGGGCAAGG + Intergenic
1190397950 X:50003691-50003713 CTGAGATGGGAGAAAGGACATGG - Intronic
1190483666 X:50902592-50902614 CTCAAATGGTAGAATCCACTAGG - Intergenic
1190844395 X:54178195-54178217 CTGAAACTGTAGAAAGGACAGGG + Intronic
1192119175 X:68438804-68438826 CTCACATGGTGGAAGGGATAAGG - Intergenic
1192266401 X:69541251-69541273 CTTAAATGGTACAAGGGGCAAGG + Intergenic
1192824215 X:74678256-74678278 CTCACATGGTGGAAGGCAGAAGG + Intergenic
1192865884 X:75131872-75131894 CTGTAATGGCAGAAGGGATATGG - Intronic
1192867629 X:75152345-75152367 CTCATGTGGTAGAAGAGACAAGG - Intronic
1193136955 X:77983015-77983037 CTCACATGGTGGAAGGGACAGGG + Intronic
1193668455 X:84353424-84353446 CTCTCATGGCAGAAGGGGCAAGG - Intronic
1193698097 X:84734327-84734349 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1193903420 X:87212770-87212792 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1194748719 X:97659816-97659838 CGCAAAAGGTAGAGGGGACTTGG - Intergenic
1194812619 X:98404568-98404590 CTCACATGGCAGAAGGGACAAGG + Intergenic
1195307462 X:103598450-103598472 CTCACATGGTAGAAGAGTGAGGG - Intergenic
1195430320 X:104781978-104782000 CTCACATGGCAGAAGGGGCAAGG - Intronic
1195627379 X:107018387-107018409 CTCACATGGTAGAAGGACAAAGG + Intergenic
1195716606 X:107825088-107825110 CTCAAAAGGTGGATGGGAGAGGG - Intergenic
1195808234 X:108799673-108799695 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1196058221 X:111378932-111378954 CTCACATGGCAGAAGGCAGAAGG - Intronic
1196076738 X:111586073-111586095 CTCACATGGTGGAAGGAACAAGG - Intergenic
1196327155 X:114420028-114420050 CTCACATGGTAGAAGGGCAAAGG - Intergenic
1196362190 X:114875125-114875147 CTCACATGGTAGAAGAGGTAAGG + Intronic
1197652439 X:129080392-129080414 CTCACATAGTAGAAGACACAAGG + Intergenic
1197712642 X:129682831-129682853 CTCACAAGGTGGAAGGGCCAAGG + Intergenic
1197914176 X:131516859-131516881 CTCACATAGTGGAAGGGACAAGG - Intergenic
1198299482 X:135321097-135321119 CTCACATGGTATAAGGTAGAAGG + Intronic
1198443081 X:136683763-136683785 CTCAAATGGAAGGAAGGAGATGG - Intronic
1198449379 X:136751669-136751691 CTTACATGGTGGAAGGGACAAGG - Intronic
1198896714 X:141463571-141463593 CTCAAGTGGTGGAAGGGGGAAGG + Intergenic
1199001321 X:142640400-142640422 CTCATATGGCAGAAGAGGCAAGG + Intergenic
1199208285 X:145174905-145174927 CTCATATGGTGGAAGGGAAAAGG - Intergenic
1199234983 X:145481233-145481255 CCCACATGGCAGAAGGGGCAGGG + Intergenic
1199279838 X:145988414-145988436 TTCACATGGCAGAAGGGACAAGG - Intergenic
1199424877 X:147689667-147689689 TTCACATGGTCAAAGGGACAAGG - Intergenic
1199736062 X:150687759-150687781 CTCACATGGCAGAAGGTAAAAGG - Intergenic
1199884095 X:152001916-152001938 CTTACATGGTAGAAGGGGCAAGG - Intergenic
1199949423 X:152695640-152695662 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1199951597 X:152711301-152711323 CTCACATGCAAGAAGGGATAAGG - Intergenic
1199958086 X:152757147-152757169 CTCACATGCAAGAAGGGATAAGG + Intergenic
1199960253 X:152772809-152772831 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1200017055 X:153173920-153173942 CTCACATGGAAGACGGGGCAAGG - Intergenic
1200326003 X:155240024-155240046 CTCATGTGGCAGAAGGGGCAAGG + Intergenic
1200808262 Y:7454948-7454970 CTTACATGGTGGAAGGGGCAAGG - Intergenic
1200842322 Y:7795385-7795407 CTCACATGGTGGAAGGCAGAAGG - Intergenic
1201446686 Y:14064600-14064622 CTCACATGGTAGAAGGGGAAAGG - Intergenic
1201492274 Y:14555375-14555397 CTCATGTGGTGGAAGGGATAAGG + Intronic
1201512511 Y:14780642-14780664 CTCACATGGTAAAAGGGATGAGG - Intronic
1201637365 Y:16139084-16139106 CTCACATGATGGAAGGGACAAGG + Intergenic
1201673836 Y:16557122-16557144 CTCACATGGTAGAAGGGGTGAGG - Intergenic
1201674382 Y:16562790-16562812 CTCATATGGTACAAGGGGCAAGG - Intergenic
1201676098 Y:16586103-16586125 CTCACATGGCAGAAGGGGCGAGG - Intergenic
1201688197 Y:16731440-16731462 CTCACATGGTAGAAGGGGCCAGG + Intergenic
1201716407 Y:17048839-17048861 CTCATCTGGGAGAAGGGAAATGG - Intergenic
1201746884 Y:17385945-17385967 CTCAAATGGTAGAAGGGGCAGGG - Intergenic
1201906412 Y:19090256-19090278 CTCACATGGTGGAAGGAACAAGG - Intergenic
1201962600 Y:19698698-19698720 CTCACACAGTGGAAGGGACAGGG + Intergenic
1202363720 Y:24139294-24139316 CTCACATGGTAGCAGGCAGAAGG + Intergenic
1202507060 Y:25530823-25530845 CTCACATGGTAGCAGGCAGAAGG - Intergenic