ID: 990565185

View in Genome Browser
Species Human (GRCh38)
Location 5:57020913-57020935
Sequence CTCTCTAAGGGGAAATTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990565177_990565185 5 Left 990565177 5:57020885-57020907 CCTTGACTATGCCTTCAGCTCCA 0: 64
1: 401
2: 362
3: 110
4: 261
Right 990565185 5:57020913-57020935 CTCTCTAAGGGGAAATTGTTGGG No data
990565178_990565185 -6 Left 990565178 5:57020896-57020918 CCTTCAGCTCCAGCTACCTCTCT No data
Right 990565185 5:57020913-57020935 CTCTCTAAGGGGAAATTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990565185 Original CRISPR CTCTCTAAGGGGAAATTGTT GGG Intergenic
No off target data available for this crispr