ID: 990566091

View in Genome Browser
Species Human (GRCh38)
Location 5:57030913-57030935
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990566087_990566091 27 Left 990566087 5:57030863-57030885 CCATCTCAGTATTTCATACTTGC No data
Right 990566091 5:57030913-57030935 CTTGTCTGCAGAGTGACGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type