ID: 990566487

View in Genome Browser
Species Human (GRCh38)
Location 5:57034758-57034780
Sequence AGGCCAGGTAGAGCAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990566487_990566491 2 Left 990566487 5:57034758-57034780 CCAGTCTCTGCTCTACCTGGCCT No data
Right 990566491 5:57034783-57034805 CATTCCCCAGAAAACAAGGCTGG No data
990566487_990566490 -2 Left 990566487 5:57034758-57034780 CCAGTCTCTGCTCTACCTGGCCT No data
Right 990566490 5:57034779-57034801 CTCTCATTCCCCAGAAAACAAGG No data
990566487_990566495 28 Left 990566487 5:57034758-57034780 CCAGTCTCTGCTCTACCTGGCCT No data
Right 990566495 5:57034809-57034831 TGTTCATAGAGTGTCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990566487 Original CRISPR AGGCCAGGTAGAGCAGAGAC TGG (reversed) Intergenic
No off target data available for this crispr